Incidental Mutation 'R7670:Myo5b'
ID592135
Institutional Source Beutler Lab
Gene Symbol Myo5b
Ensembl Gene ENSMUSG00000025885
Gene Namemyosin VB
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.687) question?
Stock #R7670 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location74440936-74771493 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74701446 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 859 (V859A)
Ref Sequence ENSEMBL: ENSMUSP00000073790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074157] [ENSMUST00000121875]
Predicted Effect probably benign
Transcript: ENSMUST00000074157
AA Change: V859A

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000073790
Gene: ENSMUSG00000025885
AA Change: V859A

DomainStartEndE-ValueType
MYSc 63 763 N/A SMART
IQ 764 786 2.41e-4 SMART
IQ 787 809 7.7e-3 SMART
IQ 812 834 2.18e-2 SMART
IQ 835 857 1.72e0 SMART
IQ 860 882 7.52e-6 SMART
IQ 883 905 4.12e-3 SMART
low complexity region 1053 1065 N/A INTRINSIC
coiled coil region 1140 1261 N/A INTRINSIC
coiled coil region 1311 1415 N/A INTRINSIC
DIL 1650 1755 7.48e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121875
AA Change: V859A

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000112728
Gene: ENSMUSG00000025885
AA Change: V859A

DomainStartEndE-ValueType
MYSc 63 763 N/A SMART
IQ 764 786 2.41e-4 SMART
IQ 787 809 7.7e-3 SMART
IQ 812 834 2.18e-2 SMART
IQ 835 857 1.72e0 SMART
IQ 860 882 7.52e-6 SMART
IQ 883 905 4.12e-3 SMART
low complexity region 1053 1065 N/A INTRINSIC
coiled coil region 1140 1261 N/A INTRINSIC
coiled coil region 1332 1441 N/A INTRINSIC
DIL 1676 1781 7.48e-51 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, together with other proteins, may be involved in plasma membrane recycling. Mutations in this gene are associated with microvillous inclusion disease. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice show perinatal mortality, diarrhea, intestinal microvillus atrophy and the presence of microvillus inclusion bodies, resembling phenotype of Microvillus Inclusion Disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik C T 16: 38,828,091 D219N possibly damaging Het
Adam26a T A 8: 43,570,153 H100L probably benign Het
Adgrf2 T C 17: 42,711,372 N187S probably damaging Het
Adipoq T A 16: 23,157,582 H244Q probably damaging Het
Arhgap40 T A 2: 158,531,925 S209T probably benign Het
Arrdc3 C T 13: 80,889,093 L123F probably damaging Het
Aspscr1 A G 11: 120,689,039 N212D probably benign Het
Ccr9 A T 9: 123,779,306 S18C probably damaging Het
Cdc42bpa T A 1: 180,065,081 V270D probably damaging Het
Clic4 A G 4: 135,217,205 Y220H probably damaging Het
Cntln A C 4: 84,979,340 H388P possibly damaging Het
Col12a1 A G 9: 79,631,643 V2457A probably damaging Het
Ctsk A G 3: 95,501,614 N103D probably benign Het
Ddx60 T C 8: 61,975,792 S779P probably damaging Het
Dnah7b T A 1: 46,109,302 D279E probably benign Het
Fam117a A G 11: 95,378,834 N308S probably benign Het
Fasn A G 11: 120,813,419 V1419A probably damaging Het
Fhad1 A G 4: 141,951,491 S625P probably benign Het
Gemin5 A G 11: 58,147,928 V585A probably benign Het
Gm5145 C A 17: 20,570,384 P8Q probably benign Het
Gm8332 T C 12: 88,249,754 N116S probably benign Het
Herc1 C A 9: 66,416,347 T1381K probably damaging Het
Herc6 T C 6: 57,660,122 I824T probably damaging Het
Klrb1 C T 6: 128,710,087 V161I probably benign Het
Krtap31-1 A G 11: 99,908,432 N154D not run Het
Lcp1 A T 14: 75,200,431 I94F probably benign Het
Lin7a A T 10: 107,382,691 Q154L possibly damaging Het
Lnx1 T C 5: 74,685,690 Y33C probably damaging Het
Ncbp1 A G 4: 46,170,015 Q696R probably damaging Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Nme8 T C 13: 19,658,829 E392G probably benign Het
Nufip1 TCAAAACA TCAAAACACAAAACA 14: 76,111,973 probably null Het
Nufip1 CAAAACAGAAAACAGAAAAC CAAAACAGAAAACAGAAAACAGAAAAC 14: 76,111,974 probably null Het
Nufip1 AAAACAG AAAACAGTAAACAG 14: 76,111,982 probably null Het
Nuggc A G 14: 65,613,526 I298V probably damaging Het
Nup155 A C 15: 8,153,696 K1247Q probably damaging Het
Olfr368 A T 2: 37,331,759 E4V probably benign Het
Olfr403 A G 11: 74,196,207 K235E probably damaging Het
Pcdhb18 T C 18: 37,491,696 V693A probably damaging Het
Pcnx3 A G 19: 5,677,182 F1108L probably benign Het
Prkca A T 11: 108,014,344 N189K probably damaging Het
Rbm24 A G 13: 46,429,207 I201V probably benign Het
Reep6 T C 10: 80,333,793 L105P probably damaging Het
Retreg1 T C 15: 25,941,040 probably benign Het
Rev3l C T 10: 39,836,722 T2382I probably benign Het
Rnf31 A G 14: 55,594,361 N230S probably benign Het
Rreb1 T C 13: 37,931,572 L969P probably benign Het
Rsph4a T A 10: 33,909,033 N313K probably damaging Het
Serpina3f T A 12: 104,217,266 L129Q probably damaging Het
Slc9a2 T A 1: 40,718,997 V232D probably damaging Het
Stmn2 T C 3: 8,554,865 L121P probably damaging Het
Svep1 C T 4: 58,097,424 G1373D probably damaging Het
Tmem206 A G 1: 191,340,868 N162S probably benign Het
Tns1 C A 1: 73,952,477 R1014L possibly damaging Het
Top2b T C 14: 16,416,620 S1127P possibly damaging Het
Txndc16 A T 14: 45,135,867 C768* probably null Het
Ubl7 A T 9: 57,929,769 E354D probably benign Het
Ush2a T C 1: 188,784,708 L3205P possibly damaging Het
Xirp2 A G 2: 67,510,573 T1053A possibly damaging Het
Zbtb21 A G 16: 97,951,877 L402P probably damaging Het
Zfp27 T A 7: 29,894,796 K581N possibly damaging Het
Zfp62 A T 11: 49,215,076 probably benign Het
Other mutations in Myo5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00798:Myo5b APN 18 74654076 splice site probably benign
IGL01083:Myo5b APN 18 74733903 splice site probably benign
IGL01448:Myo5b APN 18 74644090 missense probably damaging 0.97
IGL01516:Myo5b APN 18 74627195 missense probably damaging 0.99
IGL01525:Myo5b APN 18 74740549 missense probably damaging 1.00
IGL01873:Myo5b APN 18 74580396 missense probably damaging 1.00
IGL01887:Myo5b APN 18 74714936 missense probably benign 0.41
IGL01953:Myo5b APN 18 74569767 missense possibly damaging 0.62
IGL01976:Myo5b APN 18 74698277 missense probably damaging 1.00
IGL02017:Myo5b APN 18 74716999 missense probably damaging 1.00
IGL02331:Myo5b APN 18 74638040 critical splice acceptor site probably null
IGL02624:Myo5b APN 18 74714939 missense probably damaging 0.98
IGL02707:Myo5b APN 18 74695367 splice site probably benign
IGL02806:Myo5b APN 18 74617080 critical splice donor site probably null
IGL03009:Myo5b APN 18 74760968 missense possibly damaging 0.54
IGL03061:Myo5b APN 18 74634559 missense probably benign 0.02
IGL03061:Myo5b APN 18 74580544 splice site probably benign
unrat UTSW 18 74653361 missense possibly damaging 0.93
R0085:Myo5b UTSW 18 74701680 missense probably benign 0.21
R0114:Myo5b UTSW 18 74742171 missense probably benign 0.03
R0226:Myo5b UTSW 18 74742180 missense probably benign
R0242:Myo5b UTSW 18 74661716 missense possibly damaging 0.95
R0242:Myo5b UTSW 18 74661716 missense possibly damaging 0.95
R0471:Myo5b UTSW 18 74728954 splice site probably benign
R0494:Myo5b UTSW 18 74653967 missense probably damaging 1.00
R0920:Myo5b UTSW 18 74625641 missense probably benign 0.09
R1144:Myo5b UTSW 18 74625587 missense probably damaging 1.00
R1177:Myo5b UTSW 18 74644072 missense probably damaging 1.00
R1387:Myo5b UTSW 18 74644201 splice site probably benign
R1468:Myo5b UTSW 18 74740503 missense probably damaging 0.99
R1468:Myo5b UTSW 18 74740503 missense probably damaging 0.99
R1555:Myo5b UTSW 18 74569782 missense probably damaging 1.00
R1587:Myo5b UTSW 18 74733990 missense probably benign
R1600:Myo5b UTSW 18 74713540 unclassified probably benign
R1639:Myo5b UTSW 18 74707916 missense probably benign 0.19
R1779:Myo5b UTSW 18 74742147 missense probably benign 0.06
R1806:Myo5b UTSW 18 74577609 missense possibly damaging 0.91
R1929:Myo5b UTSW 18 74733925 missense probably damaging 0.99
R2046:Myo5b UTSW 18 74577455 missense probably benign 0.28
R2093:Myo5b UTSW 18 74759192 missense probably damaging 0.98
R2270:Myo5b UTSW 18 74733925 missense probably damaging 0.99
R2272:Myo5b UTSW 18 74733925 missense probably damaging 0.99
R2298:Myo5b UTSW 18 74625605 missense probably damaging 1.00
R2433:Myo5b UTSW 18 74759087 missense probably damaging 1.00
R2888:Myo5b UTSW 18 74762618 missense probably damaging 1.00
R3824:Myo5b UTSW 18 74661655 missense probably benign 0.41
R3937:Myo5b UTSW 18 74716037 missense probably damaging 0.98
R3938:Myo5b UTSW 18 74716037 missense probably damaging 0.98
R3947:Myo5b UTSW 18 74695403 missense probably damaging 1.00
R3971:Myo5b UTSW 18 74740527 missense probably damaging 1.00
R3972:Myo5b UTSW 18 74740527 missense probably damaging 1.00
R3974:Myo5b UTSW 18 74634481 missense probably damaging 1.00
R4027:Myo5b UTSW 18 74759240 missense possibly damaging 0.67
R4080:Myo5b UTSW 18 74740488 missense probably benign
R4285:Myo5b UTSW 18 74714849 missense probably benign
R4308:Myo5b UTSW 18 74731740 missense possibly damaging 0.89
R4411:Myo5b UTSW 18 74698274 missense possibly damaging 0.89
R4415:Myo5b UTSW 18 74580408 missense probably damaging 1.00
R4516:Myo5b UTSW 18 74625674 missense probably damaging 1.00
R4690:Myo5b UTSW 18 74722462 missense probably damaging 0.97
R4781:Myo5b UTSW 18 74744681 missense possibly damaging 0.80
R4786:Myo5b UTSW 18 74695380 missense probably benign 0.01
R4796:Myo5b UTSW 18 74744630 missense possibly damaging 0.68
R4924:Myo5b UTSW 18 74695384 missense probably benign 0.19
R4972:Myo5b UTSW 18 74627193 missense probably damaging 0.98
R5004:Myo5b UTSW 18 74744773 critical splice donor site probably null
R5024:Myo5b UTSW 18 74716034 missense possibly damaging 0.90
R5043:Myo5b UTSW 18 74638153 critical splice donor site probably null
R5187:Myo5b UTSW 18 74701674 missense possibly damaging 0.68
R5232:Myo5b UTSW 18 74714932 missense probably damaging 0.99
R5254:Myo5b UTSW 18 74700606 missense possibly damaging 0.65
R5255:Myo5b UTSW 18 74662670 missense possibly damaging 0.94
R5715:Myo5b UTSW 18 74742175 missense possibly damaging 0.88
R5733:Myo5b UTSW 18 74654057 missense possibly damaging 0.93
R5797:Myo5b UTSW 18 74701521 missense probably benign
R5875:Myo5b UTSW 18 74707902 synonymous probably null
R6088:Myo5b UTSW 18 74720898 missense possibly damaging 0.89
R6104:Myo5b UTSW 18 74700679 missense probably benign 0.19
R6237:Myo5b UTSW 18 74742178 missense probably damaging 1.00
R6265:Myo5b UTSW 18 74577440 splice site probably null
R6267:Myo5b UTSW 18 74616991 missense probably damaging 1.00
R6328:Myo5b UTSW 18 74616993 missense probably damaging 1.00
R6330:Myo5b UTSW 18 74616993 missense probably damaging 1.00
R6331:Myo5b UTSW 18 74616993 missense probably damaging 1.00
R6347:Myo5b UTSW 18 74770385 missense probably benign 0.11
R6479:Myo5b UTSW 18 74617015 missense probably damaging 1.00
R6748:Myo5b UTSW 18 74701503 missense possibly damaging 0.80
R6749:Myo5b UTSW 18 74701503 missense possibly damaging 0.80
R6750:Myo5b UTSW 18 74617035 missense possibly damaging 0.74
R6833:Myo5b UTSW 18 74770325 missense probably benign
R6876:Myo5b UTSW 18 74707955 missense probably benign
R6880:Myo5b UTSW 18 74722430 missense probably benign 0.02
R6902:Myo5b UTSW 18 74676685 missense possibly damaging 0.95
R6985:Myo5b UTSW 18 74653361 missense possibly damaging 0.93
R7039:Myo5b UTSW 18 74701528 missense probably benign 0.01
R7162:Myo5b UTSW 18 74695427 missense probably benign 0.02
R7345:Myo5b UTSW 18 74708024 missense possibly damaging 0.82
R7530:Myo5b UTSW 18 74731731 missense probably benign 0.00
R7564:Myo5b UTSW 18 74634511 missense possibly damaging 0.84
R7629:Myo5b UTSW 18 74627254 critical splice donor site probably null
R7635:Myo5b UTSW 18 74580396 missense probably damaging 1.00
R7754:Myo5b UTSW 18 74634559 missense probably benign 0.02
RF009:Myo5b UTSW 18 74643999 missense probably damaging 1.00
Z1088:Myo5b UTSW 18 74744749 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- AACAAGAGTTTGTCAGCCACTC -3'
(R):5'- TTGAGGCGTTTCAGATGCTC -3'

Sequencing Primer
(F):5'- TCCTGTGTACACAAGGTCTACAG -3'
(R):5'- CGTTTCAGATGCTCTGCCGAG -3'
Posted On2019-11-12