Incidental Mutation 'R7671:Tram1'
ID 592137
Institutional Source Beutler Lab
Gene Symbol Tram1
Ensembl Gene ENSMUSG00000025935
Gene Name translocating chain-associating membrane protein 1
Synonyms TRAMP, 1810049E02Rik
Accession Numbers
Essential gene? Possibly essential (E-score: 0.578) question?
Stock # R7671 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 13634922-13660134 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 13659868 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 27 (V27F)
Ref Sequence ENSEMBL: ENSMUSP00000027068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027068] [ENSMUST00000188377]
AlphaFold Q91V04
Predicted Effect probably damaging
Transcript: ENSMUST00000027068
AA Change: V27F

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000027068
Gene: ENSMUSG00000025935
AA Change: V27F

DomainStartEndE-ValueType
Pfam:TRAM1 47 115 6.1e-24 PFAM
TLC 117 326 2.36e-54 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000188377
AA Change: V27F

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140499
Gene: ENSMUSG00000025935
AA Change: V27F

DomainStartEndE-ValueType
Blast:TLC 9 58 5e-24 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a multi-pass transmembrane protein of the endoplasmic reticulum (ER). It is involved in the process of cotranslational translocation of secretory proteins into the ER. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 C A 7: 75,219,648 (GRCm39) T17K probably damaging Het
Ankrd29 T A 18: 12,394,043 (GRCm39) K257I probably damaging Het
Bicc1 A G 10: 70,792,997 (GRCm39) L219P probably benign Het
Bltp1 T C 3: 36,997,380 (GRCm39) F1146L probably damaging Het
Boc C T 16: 44,312,212 (GRCm39) V617M Het
Ccl8 A G 11: 82,006,033 (GRCm39) probably benign Het
Col18a1 A G 10: 76,921,217 (GRCm39) L261P unknown Het
Col5a3 T A 9: 20,686,382 (GRCm39) probably null Het
Cryba4 A C 5: 112,396,039 (GRCm39) probably null Het
Csf2rb A G 15: 78,223,130 (GRCm39) Y114C probably damaging Het
Ctif T C 18: 75,605,087 (GRCm39) D484G probably damaging Het
Ctnnal1 A G 4: 56,837,848 (GRCm39) F261L probably damaging Het
Defb22 A T 2: 152,327,950 (GRCm39) N78K unknown Het
Dele1 T A 18: 38,392,978 (GRCm39) I394N probably damaging Het
Efr3a G A 15: 65,709,283 (GRCm39) probably null Het
Elp4 G T 2: 105,734,826 (GRCm39) A3E probably damaging Het
Emilin2 A G 17: 71,580,905 (GRCm39) V607A probably benign Het
Epsti1 A G 14: 78,141,930 (GRCm39) Y2C probably damaging Het
Fam81b A C 13: 76,419,412 (GRCm39) L46R probably damaging Het
Fam81b G T 13: 76,419,413 (GRCm39) L46I possibly damaging Het
Fbxo15 T A 18: 84,982,278 (GRCm39) H288Q probably damaging Het
Gabrg1 T A 5: 70,973,323 (GRCm39) N77I probably damaging Het
Ganab A G 19: 8,890,216 (GRCm39) Y715C possibly damaging Het
H2bc27 T C 11: 58,840,102 (GRCm39) S113P possibly damaging Het
Iqgap2 T C 13: 95,764,627 (GRCm39) D1539G probably damaging Het
Kcp T C 6: 29,496,516 (GRCm39) N633S probably benign Het
Krt6a C A 15: 101,598,978 (GRCm39) S529I unknown Het
Leo1 A G 9: 75,352,844 (GRCm39) H129R probably benign Het
Lmf1 G A 17: 25,798,323 (GRCm39) V55M possibly damaging Het
Mcm9 A G 10: 53,413,665 (GRCm39) S472P probably benign Het
Med27 T A 2: 29,267,950 (GRCm39) V33D Het
Mgat4f T C 1: 134,317,800 (GRCm39) C191R probably benign Het
Mup15 C T 4: 61,356,526 (GRCm39) E80K probably benign Het
Myo18a G A 11: 77,750,246 (GRCm39) R199H Het
Nebl T A 2: 17,395,727 (GRCm39) R558* probably null Het
Or10ak8 A T 4: 118,774,183 (GRCm39) H160Q probably benign Het
Or11g7 G T 14: 50,691,342 (GRCm39) V278L probably benign Het
Or12e9 A G 2: 87,202,613 (GRCm39) T246A probably damaging Het
Or4a79 A T 2: 89,551,603 (GRCm39) I284K probably damaging Het
Or5p78 T C 7: 108,212,198 (GRCm39) I228T probably damaging Het
Or6c217 T C 10: 129,738,222 (GRCm39) D119G probably damaging Het
Or8b41 A T 9: 38,054,736 (GRCm39) M97L probably benign Het
Pde11a A T 2: 76,045,697 (GRCm39) F376I possibly damaging Het
Prima1 A T 12: 103,201,920 (GRCm39) C52S probably damaging Het
Pxn G A 5: 115,686,606 (GRCm39) R366H not run Het
Sgce T C 6: 4,691,564 (GRCm39) Y337C probably damaging Het
Slc25a10 T A 11: 120,386,286 (GRCm39) M130K probably benign Het
Slc29a2 A T 19: 5,074,290 (GRCm39) N5I probably benign Het
Slc35a1 A T 4: 34,673,875 (GRCm39) H150Q Het
Slc5a4a T A 10: 75,983,384 (GRCm39) V7D unknown Het
Stk17b T A 1: 53,805,159 (GRCm39) D134V probably damaging Het
Tex55 C T 16: 38,648,453 (GRCm39) D219N possibly damaging Het
Thbs3 T A 3: 89,124,014 (GRCm39) S36T probably benign Het
Thsd4 A G 9: 60,335,457 (GRCm39) S152P probably benign Het
Tmem67 G T 4: 12,063,698 (GRCm39) H422N probably benign Het
Trim14 A G 4: 46,507,238 (GRCm39) V326A possibly damaging Het
Other mutations in Tram1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Tram1 APN 1 13,649,673 (GRCm39) critical splice donor site probably null
IGL03071:Tram1 APN 1 13,649,998 (GRCm39) nonsense probably null
IGL03123:Tram1 APN 1 13,659,829 (GRCm39) missense probably benign 0.01
R0764:Tram1 UTSW 1 13,649,933 (GRCm39) missense probably damaging 1.00
R1229:Tram1 UTSW 1 13,639,776 (GRCm39) missense probably damaging 0.98
R1775:Tram1 UTSW 1 13,646,680 (GRCm39) unclassified probably benign
R3877:Tram1 UTSW 1 13,639,827 (GRCm39) missense probably benign 0.01
R4077:Tram1 UTSW 1 13,636,599 (GRCm39) missense probably benign
R4747:Tram1 UTSW 1 13,659,870 (GRCm39) missense probably damaging 1.00
R5197:Tram1 UTSW 1 13,642,126 (GRCm39) missense probably benign 0.19
R5213:Tram1 UTSW 1 13,649,966 (GRCm39) missense probably damaging 1.00
R5224:Tram1 UTSW 1 13,648,349 (GRCm39) missense probably benign 0.10
R7362:Tram1 UTSW 1 13,659,832 (GRCm39) missense probably benign 0.04
R7587:Tram1 UTSW 1 13,649,771 (GRCm39) missense probably damaging 0.99
R7988:Tram1 UTSW 1 13,640,199 (GRCm39) missense probably benign 0.04
R9047:Tram1 UTSW 1 13,639,830 (GRCm39) missense probably benign
R9749:Tram1 UTSW 1 13,640,238 (GRCm39) missense possibly damaging 0.95
RF015:Tram1 UTSW 1 13,649,966 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGGTCCCTGTTAGTCATC -3'
(R):5'- TGAACCATTCCCAGGAAGC -3'

Sequencing Primer
(F):5'- GGCTGCCACGTAACCCTTC -3'
(R):5'- ATTCCCAGGAAGCTCGCG -3'
Posted On 2019-11-12