Incidental Mutation 'R7671:Med27'
ID592141
Institutional Source Beutler Lab
Gene Symbol Med27
Ensembl Gene ENSMUSG00000026799
Gene Namemediator complex subunit 27
SynonymsD2Ertd434e, Crsp8, 1500015J03Rik, 2310042P07Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.943) question?
Stock #R7671 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location29346819-29524793 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 29377938 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 33 (V33D)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028139] [ENSMUST00000113830] [ENSMUST00000159034] [ENSMUST00000159280] [ENSMUST00000162597] [ENSMUST00000162623]
Predicted Effect probably benign
Transcript: ENSMUST00000028139
SMART Domains Protein: ENSMUSP00000028139
Gene: ENSMUSG00000026799

DomainStartEndE-ValueType
Pfam:Med27 228 310 7.2e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113830
Predicted Effect probably benign
Transcript: ENSMUST00000159034
Predicted Effect probably benign
Transcript: ENSMUST00000159280
SMART Domains Protein: ENSMUSP00000125390
Gene: ENSMUSG00000026799

DomainStartEndE-ValueType
Pfam:Med27 85 171 1.4e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162597
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000162623
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 5. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T A 18: 38,259,925 I394N probably damaging Het
4930435E12Rik C T 16: 38,828,091 D219N possibly damaging Het
4932438A13Rik T C 3: 36,943,231 F1146L probably damaging Het
4933406M09Rik T C 1: 134,390,062 C191R probably benign Het
Akap13 C A 7: 75,569,900 T17K probably damaging Het
Ankrd29 T A 18: 12,260,986 K257I probably damaging Het
Bicc1 A G 10: 70,957,167 L219P probably benign Het
Boc C T 16: 44,491,849 V617M Het
Ccl8 A G 11: 82,115,207 probably benign Het
Col18a1 A G 10: 77,085,383 L261P unknown Het
Col5a3 T A 9: 20,775,086 probably null Het
Cryba4 A C 5: 112,248,173 probably null Het
Csf2rb A G 15: 78,338,930 Y114C probably damaging Het
Ctif T C 18: 75,472,016 D484G probably damaging Het
Ctnnal1 A G 4: 56,837,848 F261L probably damaging Het
Defb22 A T 2: 152,486,030 N78K unknown Het
Efr3a G A 15: 65,837,434 probably null Het
Elp4 G T 2: 105,904,481 A3E probably damaging Het
Emilin2 A G 17: 71,273,910 V607A probably benign Het
Epsti1 A G 14: 77,904,490 Y2C probably damaging Het
Fam81b A C 13: 76,271,293 L46R probably damaging Het
Fam81b G T 13: 76,271,294 L46I possibly damaging Het
Fbxo15 T A 18: 84,964,153 H288Q probably damaging Het
Gabrg1 T A 5: 70,815,980 N77I probably damaging Het
Ganab A G 19: 8,912,852 Y715C possibly damaging Het
Hist3h2ba T C 11: 58,949,276 S113P possibly damaging Het
Iqgap2 T C 13: 95,628,119 D1539G probably damaging Het
Kcp T C 6: 29,496,517 N633S probably benign Het
Krt6a C A 15: 101,690,543 S529I unknown Het
Leo1 A G 9: 75,445,562 H129R probably benign Het
Lmf1 G A 17: 25,579,349 V55M possibly damaging Het
Mcm9 A G 10: 53,537,569 S472P probably benign Het
Mup15 C T 4: 61,438,289 E80K probably benign Het
Myo18a G A 11: 77,859,420 R199H Het
Nebl T A 2: 17,390,916 R558* probably null Het
Olfr1121 A G 2: 87,372,269 T246A probably damaging Het
Olfr1252 A T 2: 89,721,259 I284K probably damaging Het
Olfr1329 A T 4: 118,916,986 H160Q probably benign Het
Olfr506 T C 7: 108,612,991 I228T probably damaging Het
Olfr740 G T 14: 50,453,885 V278L probably benign Het
Olfr815 T C 10: 129,902,353 D119G probably damaging Het
Olfr890 A T 9: 38,143,440 M97L probably benign Het
Pde11a A T 2: 76,215,353 F376I possibly damaging Het
Prima1 A T 12: 103,235,661 C52S probably damaging Het
Pxn G A 5: 115,548,547 R366H not run Het
Sgce T C 6: 4,691,564 Y337C probably damaging Het
Slc25a10 T A 11: 120,495,460 M130K probably benign Het
Slc29a2 A T 19: 5,024,262 N5I probably benign Het
Slc35a1 A T 4: 34,673,875 H150Q Het
Slc5a4a T A 10: 76,147,550 V7D unknown Het
Stk17b T A 1: 53,766,000 D134V probably damaging Het
Thbs3 T A 3: 89,216,707 S36T probably benign Het
Thsd4 A G 9: 60,428,174 S152P probably benign Het
Tmem67 G T 4: 12,063,698 H422N probably benign Het
Tram1 C A 1: 13,589,644 V27F probably damaging Het
Trim14 A G 4: 46,507,238 V326A possibly damaging Het
Other mutations in Med27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01886:Med27 APN 2 29413482 missense probably damaging 1.00
R0427:Med27 UTSW 2 29500271 missense probably damaging 1.00
R1769:Med27 UTSW 2 29500295 missense probably damaging 0.99
R2126:Med27 UTSW 2 29524430 nonsense probably null
R3196:Med27 UTSW 2 29346870 missense possibly damaging 0.86
R4093:Med27 UTSW 2 29377908 unclassified probably benign
R4498:Med27 UTSW 2 29471342 missense probably damaging 0.99
R4599:Med27 UTSW 2 29524458 missense probably damaging 1.00
R4722:Med27 UTSW 2 29524435 missense probably damaging 0.98
R4771:Med27 UTSW 2 29413503 missense probably damaging 1.00
R4828:Med27 UTSW 2 29377938 unclassified probably benign
R5870:Med27 UTSW 2 29389811 critical splice acceptor site probably null
R6061:Med27 UTSW 2 29509441 missense probably damaging 0.99
R6159:Med27 UTSW 2 29524364 splice site probably null
R7028:Med27 UTSW 2 29509434 nonsense probably null
R7319:Med27 UTSW 2 29413478 missense possibly damaging 0.53
R7387:Med27 UTSW 2 29413407 missense possibly damaging 0.96
R8255:Med27 UTSW 2 29524364 splice site probably null
Predicted Primers PCR Primer
(F):5'- GCACCAGGGTCATCTTGTTAATTC -3'
(R):5'- CCTAAATCAGGCTCTGCAGAC -3'

Sequencing Primer
(F):5'- AATTCCTGATGCAGCTCTGGAG -3'
(R):5'- CAAAGTCTTGCCATTCCGAGATGAG -3'
Posted On2019-11-12