Incidental Mutation 'R7671:Olfr1121'
ID592143
Institutional Source Beutler Lab
Gene Symbol Olfr1121
Ensembl Gene ENSMUSG00000070852
Gene Nameolfactory receptor 1121
SynonymsMOR264-18, GA_x6K02T2Q125-48863863-48864807
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R7671 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location87369895-87373469 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87372269 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 246 (T246A)
Ref Sequence ENSEMBL: ENSMUSP00000150120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062555] [ENSMUST00000213792]
Predicted Effect probably damaging
Transcript: ENSMUST00000062555
AA Change: T246A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058201
Gene: ENSMUSG00000070852
AA Change: T246A

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 3.3e-54 PFAM
Pfam:7tm_1 47 296 3.2e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213792
AA Change: T246A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T A 18: 38,259,925 I394N probably damaging Het
4930435E12Rik C T 16: 38,828,091 D219N possibly damaging Het
4932438A13Rik T C 3: 36,943,231 F1146L probably damaging Het
4933406M09Rik T C 1: 134,390,062 C191R probably benign Het
Akap13 C A 7: 75,569,900 T17K probably damaging Het
Ankrd29 T A 18: 12,260,986 K257I probably damaging Het
Bicc1 A G 10: 70,957,167 L219P probably benign Het
Boc C T 16: 44,491,849 V617M Het
Ccl8 A G 11: 82,115,207 probably benign Het
Col18a1 A G 10: 77,085,383 L261P unknown Het
Col5a3 T A 9: 20,775,086 probably null Het
Cryba4 A C 5: 112,248,173 probably null Het
Csf2rb A G 15: 78,338,930 Y114C probably damaging Het
Ctif T C 18: 75,472,016 D484G probably damaging Het
Ctnnal1 A G 4: 56,837,848 F261L probably damaging Het
Defb22 A T 2: 152,486,030 N78K unknown Het
Efr3a G A 15: 65,837,434 probably null Het
Elp4 G T 2: 105,904,481 A3E probably damaging Het
Emilin2 A G 17: 71,273,910 V607A probably benign Het
Epsti1 A G 14: 77,904,490 Y2C probably damaging Het
Fam81b A C 13: 76,271,293 L46R probably damaging Het
Fam81b G T 13: 76,271,294 L46I possibly damaging Het
Fbxo15 T A 18: 84,964,153 H288Q probably damaging Het
Gabrg1 T A 5: 70,815,980 N77I probably damaging Het
Ganab A G 19: 8,912,852 Y715C possibly damaging Het
Hist3h2ba T C 11: 58,949,276 S113P possibly damaging Het
Iqgap2 T C 13: 95,628,119 D1539G probably damaging Het
Kcp T C 6: 29,496,517 N633S probably benign Het
Krt6a C A 15: 101,690,543 S529I unknown Het
Leo1 A G 9: 75,445,562 H129R probably benign Het
Lmf1 G A 17: 25,579,349 V55M possibly damaging Het
Mcm9 A G 10: 53,537,569 S472P probably benign Het
Med27 T A 2: 29,377,938 V33D Het
Mup15 C T 4: 61,438,289 E80K probably benign Het
Myo18a G A 11: 77,859,420 R199H Het
Nebl T A 2: 17,390,916 R558* probably null Het
Olfr1252 A T 2: 89,721,259 I284K probably damaging Het
Olfr1329 A T 4: 118,916,986 H160Q probably benign Het
Olfr506 T C 7: 108,612,991 I228T probably damaging Het
Olfr740 G T 14: 50,453,885 V278L probably benign Het
Olfr815 T C 10: 129,902,353 D119G probably damaging Het
Olfr890 A T 9: 38,143,440 M97L probably benign Het
Pde11a A T 2: 76,215,353 F376I possibly damaging Het
Prima1 A T 12: 103,235,661 C52S probably damaging Het
Pxn G A 5: 115,548,547 R366H not run Het
Sgce T C 6: 4,691,564 Y337C probably damaging Het
Slc25a10 T A 11: 120,495,460 M130K probably benign Het
Slc29a2 A T 19: 5,024,262 N5I probably benign Het
Slc35a1 A T 4: 34,673,875 H150Q Het
Slc5a4a T A 10: 76,147,550 V7D unknown Het
Stk17b T A 1: 53,766,000 D134V probably damaging Het
Thbs3 T A 3: 89,216,707 S36T probably benign Het
Thsd4 A G 9: 60,428,174 S152P probably benign Het
Tmem67 G T 4: 12,063,698 H422N probably benign Het
Tram1 C A 1: 13,589,644 V27F probably damaging Het
Trim14 A G 4: 46,507,238 V326A possibly damaging Het
Other mutations in Olfr1121
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02534:Olfr1121 APN 2 87372254 missense probably benign
IGL03280:Olfr1121 APN 2 87372123 missense probably damaging 1.00
R0501:Olfr1121 UTSW 2 87371552 missense probably damaging 0.96
R1350:Olfr1121 UTSW 2 87372357 missense probably benign
R1713:Olfr1121 UTSW 2 87371946 missense probably damaging 1.00
R2404:Olfr1121 UTSW 2 87372224 missense probably benign 0.09
R4737:Olfr1121 UTSW 2 87372321 missense probably damaging 0.99
R4825:Olfr1121 UTSW 2 87372088 nonsense probably null
R5109:Olfr1121 UTSW 2 87371534 start codon destroyed probably null 0.04
R5200:Olfr1121 UTSW 2 87372102 missense probably damaging 0.99
R6393:Olfr1121 UTSW 2 87371565 missense probably damaging 1.00
R6658:Olfr1121 UTSW 2 87372153 missense probably benign 0.01
R7011:Olfr1121 UTSW 2 87372260 missense possibly damaging 0.74
R7427:Olfr1121 UTSW 2 87371690 missense probably benign 0.01
R7428:Olfr1121 UTSW 2 87371690 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCTTAAACTGGCCTGTGGAG -3'
(R):5'- GAGACCTGAGATTGTATTTCTGTCAC -3'

Sequencing Primer
(F):5'- GGAGACACTTCTGTTATTGAGATG -3'
(R):5'- GTAAGCAACAATCTTCTCAGAGCTG -3'
Posted On2019-11-12