Incidental Mutation 'R7671:Elp4'
ID592145
Institutional Source Beutler Lab
Gene Symbol Elp4
Ensembl Gene ENSMUSG00000027167
Gene Nameelongator acetyltransferase complex subunit 4
SynonymsA330107A17Rik, Paxneb
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R7671 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location105701027-105904564 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 105904481 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 3 (A3E)
Ref Sequence ENSEMBL: ENSMUSP00000116575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037499] [ENSMUST00000122965]
Predicted Effect probably benign
Transcript: ENSMUST00000037499
SMART Domains Protein: ENSMUSP00000049044
Gene: ENSMUSG00000042670

DomainStartEndE-ValueType
Pfam:Peptidase_S24 36 107 1.8e-16 PFAM
Pfam:Peptidase_S26 95 146 1e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122965
AA Change: A3E

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116575
Gene: ENSMUSG00000027167
AA Change: A3E

DomainStartEndE-ValueType
Pfam:PAXNEB 28 422 4e-123 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the six subunit elongator complex, a histone acetyltransferase complex that associates directly with RNA polymerase II during transcriptional elongation. The human gene can partially complement sensitivity phenotypes of yeast ELP4 deletion mutants. This gene has also been associated with Rolandic epilepsy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T A 18: 38,259,925 I394N probably damaging Het
4930435E12Rik C T 16: 38,828,091 D219N possibly damaging Het
4932438A13Rik T C 3: 36,943,231 F1146L probably damaging Het
4933406M09Rik T C 1: 134,390,062 C191R probably benign Het
Akap13 C A 7: 75,569,900 T17K probably damaging Het
Ankrd29 T A 18: 12,260,986 K257I probably damaging Het
Bicc1 A G 10: 70,957,167 L219P probably benign Het
Boc C T 16: 44,491,849 V617M Het
Ccl8 A G 11: 82,115,207 probably benign Het
Col18a1 A G 10: 77,085,383 L261P unknown Het
Col5a3 T A 9: 20,775,086 probably null Het
Cryba4 A C 5: 112,248,173 probably null Het
Csf2rb A G 15: 78,338,930 Y114C probably damaging Het
Ctif T C 18: 75,472,016 D484G probably damaging Het
Ctnnal1 A G 4: 56,837,848 F261L probably damaging Het
Defb22 A T 2: 152,486,030 N78K unknown Het
Efr3a G A 15: 65,837,434 probably null Het
Emilin2 A G 17: 71,273,910 V607A probably benign Het
Epsti1 A G 14: 77,904,490 Y2C probably damaging Het
Fam81b A C 13: 76,271,293 L46R probably damaging Het
Fam81b G T 13: 76,271,294 L46I possibly damaging Het
Fbxo15 T A 18: 84,964,153 H288Q probably damaging Het
Gabrg1 T A 5: 70,815,980 N77I probably damaging Het
Ganab A G 19: 8,912,852 Y715C possibly damaging Het
Hist3h2ba T C 11: 58,949,276 S113P possibly damaging Het
Iqgap2 T C 13: 95,628,119 D1539G probably damaging Het
Kcp T C 6: 29,496,517 N633S probably benign Het
Krt6a C A 15: 101,690,543 S529I unknown Het
Leo1 A G 9: 75,445,562 H129R probably benign Het
Lmf1 G A 17: 25,579,349 V55M possibly damaging Het
Mcm9 A G 10: 53,537,569 S472P probably benign Het
Med27 T A 2: 29,377,938 V33D Het
Mup15 C T 4: 61,438,289 E80K probably benign Het
Myo18a G A 11: 77,859,420 R199H Het
Nebl T A 2: 17,390,916 R558* probably null Het
Olfr1121 A G 2: 87,372,269 T246A probably damaging Het
Olfr1252 A T 2: 89,721,259 I284K probably damaging Het
Olfr1329 A T 4: 118,916,986 H160Q probably benign Het
Olfr506 T C 7: 108,612,991 I228T probably damaging Het
Olfr740 G T 14: 50,453,885 V278L probably benign Het
Olfr815 T C 10: 129,902,353 D119G probably damaging Het
Olfr890 A T 9: 38,143,440 M97L probably benign Het
Pde11a A T 2: 76,215,353 F376I possibly damaging Het
Prima1 A T 12: 103,235,661 C52S probably damaging Het
Pxn G A 5: 115,548,547 R366H not run Het
Sgce T C 6: 4,691,564 Y337C probably damaging Het
Slc25a10 T A 11: 120,495,460 M130K probably benign Het
Slc29a2 A T 19: 5,024,262 N5I probably benign Het
Slc35a1 A T 4: 34,673,875 H150Q Het
Slc5a4a T A 10: 76,147,550 V7D unknown Het
Stk17b T A 1: 53,766,000 D134V probably damaging Het
Thbs3 T A 3: 89,216,707 S36T probably benign Het
Thsd4 A G 9: 60,428,174 S152P probably benign Het
Tmem67 G T 4: 12,063,698 H422N probably benign Het
Tram1 C A 1: 13,589,644 V27F probably damaging Het
Trim14 A G 4: 46,507,238 V326A possibly damaging Het
Other mutations in Elp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00648:Elp4 APN 2 105842366 splice site probably benign
IGL01407:Elp4 APN 2 105792308 missense probably damaging 1.00
IGL02173:Elp4 APN 2 105702743 missense probably damaging 0.96
IGL02370:Elp4 APN 2 105794592 missense probably damaging 1.00
R0125:Elp4 UTSW 2 105792214 critical splice donor site probably null
R0685:Elp4 UTSW 2 105792277 missense possibly damaging 0.94
R0893:Elp4 UTSW 2 105896945 splice site probably benign
R1117:Elp4 UTSW 2 105842311 missense probably benign 0.00
R1496:Elp4 UTSW 2 105832161 missense probably benign 0.31
R1542:Elp4 UTSW 2 105794609 missense probably benign 0.02
R1911:Elp4 UTSW 2 105702743 missense probably damaging 0.96
R2311:Elp4 UTSW 2 105842332 missense probably benign 0.00
R2997:Elp4 UTSW 2 105814316 missense possibly damaging 0.82
R3079:Elp4 UTSW 2 105809445 missense possibly damaging 0.95
R3683:Elp4 UTSW 2 105702761 missense possibly damaging 0.75
R4747:Elp4 UTSW 2 105794607 missense probably damaging 1.00
R4799:Elp4 UTSW 2 105809267 missense probably damaging 0.99
R5438:Elp4 UTSW 2 105904403 missense probably damaging 1.00
R5635:Elp4 UTSW 2 105814264 critical splice donor site probably null
R6414:Elp4 UTSW 2 105904443 missense possibly damaging 0.94
R7228:Elp4 UTSW 2 105792302 missense probably damaging 1.00
R7381:Elp4 UTSW 2 105792307 missense not run
R7560:Elp4 UTSW 2 105794588 missense probably damaging 1.00
R8376:Elp4 UTSW 2 105842308 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TATTCTGAACCGACCTAAGAGCTG -3'
(R):5'- TTACGCACCGCACTTTTCAG -3'

Sequencing Primer
(F):5'- GTTGACACCAGCAGTTGTCC -3'
(R):5'- CGCACTTTTCAGCAATAGGC -3'
Posted On2019-11-12