Incidental Mutation 'R7671:Trim14'
ID592151
Institutional Source Beutler Lab
Gene Symbol Trim14
Ensembl Gene ENSMUSG00000039853
Gene Nametripartite motif-containing 14
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7671 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location46493781-46536141 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46507238 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 326 (V326A)
Ref Sequence ENSEMBL: ENSMUSP00000038719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030018] [ENSMUST00000046897] [ENSMUST00000102924] [ENSMUST00000184112]
Predicted Effect probably benign
Transcript: ENSMUST00000030018
SMART Domains Protein: ENSMUSP00000030018
Gene: ENSMUSG00000028334

DomainStartEndE-ValueType
Pfam:NeuB 39 278 4.7e-81 PFAM
SAF 292 351 2.38e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000046897
AA Change: V326A

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000038719
Gene: ENSMUSG00000039853
AA Change: V326A

DomainStartEndE-ValueType
BBOX 17 59 1.84e-8 SMART
low complexity region 115 126 N/A INTRINSIC
PRY 264 316 2.63e-13 SMART
SPRY 317 440 2.48e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102924
SMART Domains Protein: ENSMUSP00000099988
Gene: ENSMUSG00000039853

DomainStartEndE-ValueType
BBOX 17 59 1.84e-8 SMART
low complexity region 115 126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184112
SMART Domains Protein: ENSMUSP00000138876
Gene: ENSMUSG00000039853

DomainStartEndE-ValueType
BBOX 17 59 1.84e-8 SMART
low complexity region 115 126 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic bodies and its function has not been determined. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T A 18: 38,259,925 I394N probably damaging Het
4930435E12Rik C T 16: 38,828,091 D219N possibly damaging Het
4932438A13Rik T C 3: 36,943,231 F1146L probably damaging Het
4933406M09Rik T C 1: 134,390,062 C191R probably benign Het
Akap13 C A 7: 75,569,900 T17K probably damaging Het
Ankrd29 T A 18: 12,260,986 K257I probably damaging Het
Bicc1 A G 10: 70,957,167 L219P probably benign Het
Boc C T 16: 44,491,849 V617M Het
Ccl8 A G 11: 82,115,207 probably benign Het
Col18a1 A G 10: 77,085,383 L261P unknown Het
Col5a3 T A 9: 20,775,086 probably null Het
Cryba4 A C 5: 112,248,173 probably null Het
Csf2rb A G 15: 78,338,930 Y114C probably damaging Het
Ctif T C 18: 75,472,016 D484G probably damaging Het
Ctnnal1 A G 4: 56,837,848 F261L probably damaging Het
Defb22 A T 2: 152,486,030 N78K unknown Het
Efr3a G A 15: 65,837,434 probably null Het
Elp4 G T 2: 105,904,481 A3E probably damaging Het
Emilin2 A G 17: 71,273,910 V607A probably benign Het
Epsti1 A G 14: 77,904,490 Y2C probably damaging Het
Fam81b A C 13: 76,271,293 L46R probably damaging Het
Fam81b G T 13: 76,271,294 L46I possibly damaging Het
Fbxo15 T A 18: 84,964,153 H288Q probably damaging Het
Gabrg1 T A 5: 70,815,980 N77I probably damaging Het
Ganab A G 19: 8,912,852 Y715C possibly damaging Het
Hist3h2ba T C 11: 58,949,276 S113P possibly damaging Het
Iqgap2 T C 13: 95,628,119 D1539G probably damaging Het
Kcp T C 6: 29,496,517 N633S probably benign Het
Krt6a C A 15: 101,690,543 S529I unknown Het
Leo1 A G 9: 75,445,562 H129R probably benign Het
Lmf1 G A 17: 25,579,349 V55M possibly damaging Het
Mcm9 A G 10: 53,537,569 S472P probably benign Het
Med27 T A 2: 29,377,938 V33D Het
Mup15 C T 4: 61,438,289 E80K probably benign Het
Myo18a G A 11: 77,859,420 R199H Het
Nebl T A 2: 17,390,916 R558* probably null Het
Olfr1121 A G 2: 87,372,269 T246A probably damaging Het
Olfr1252 A T 2: 89,721,259 I284K probably damaging Het
Olfr1329 A T 4: 118,916,986 H160Q probably benign Het
Olfr506 T C 7: 108,612,991 I228T probably damaging Het
Olfr740 G T 14: 50,453,885 V278L probably benign Het
Olfr815 T C 10: 129,902,353 D119G probably damaging Het
Olfr890 A T 9: 38,143,440 M97L probably benign Het
Pde11a A T 2: 76,215,353 F376I possibly damaging Het
Prima1 A T 12: 103,235,661 C52S probably damaging Het
Pxn G A 5: 115,548,547 R366H not run Het
Sgce T C 6: 4,691,564 Y337C probably damaging Het
Slc25a10 T A 11: 120,495,460 M130K probably benign Het
Slc29a2 A T 19: 5,024,262 N5I probably benign Het
Slc35a1 A T 4: 34,673,875 H150Q Het
Slc5a4a T A 10: 76,147,550 V7D unknown Het
Stk17b T A 1: 53,766,000 D134V probably damaging Het
Thbs3 T A 3: 89,216,707 S36T probably benign Het
Thsd4 A G 9: 60,428,174 S152P probably benign Het
Tmem67 G T 4: 12,063,698 H422N probably benign Het
Tram1 C A 1: 13,589,644 V27F probably damaging Het
Other mutations in Trim14
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0034:Trim14 UTSW 4 46523627 missense probably damaging 0.99
R0310:Trim14 UTSW 4 46522043 missense probably damaging 0.99
R1766:Trim14 UTSW 4 46522039 missense probably benign 0.00
R3436:Trim14 UTSW 4 46523739 missense possibly damaging 0.63
R3437:Trim14 UTSW 4 46523739 missense possibly damaging 0.63
R4085:Trim14 UTSW 4 46523709 missense probably benign 0.03
R4086:Trim14 UTSW 4 46523709 missense probably benign 0.03
R4087:Trim14 UTSW 4 46523709 missense probably benign 0.03
R4088:Trim14 UTSW 4 46523709 missense probably benign 0.03
R4992:Trim14 UTSW 4 46507110 missense probably damaging 1.00
R5408:Trim14 UTSW 4 46507134 missense possibly damaging 0.63
R5943:Trim14 UTSW 4 46522136 missense probably benign 0.01
R5979:Trim14 UTSW 4 46507239 missense probably damaging 0.97
R6029:Trim14 UTSW 4 46506998 missense probably benign 0.33
R6303:Trim14 UTSW 4 46522118 missense probably benign 0.00
R6304:Trim14 UTSW 4 46522118 missense probably benign 0.00
R6312:Trim14 UTSW 4 46507257 missense probably damaging 1.00
R7996:Trim14 UTSW 4 46533086 missense probably benign 0.04
Z1176:Trim14 UTSW 4 46510418 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTCGTAGAAGGCCAGAATGC -3'
(R):5'- AGGCTTTCTGACAGCTGTC -3'

Sequencing Primer
(F):5'- TCGTAGTCCAGGAAGACGC -3'
(R):5'- TACGCCAACGCTGGACC -3'
Posted On2019-11-12