Mutagenetix > Incidental Mutations

Incidental Mutation 'R7671:Gabrg1'

592155

Institutional Source

Beutler Lab

Gene Symbol

Gabrg1

Ensembl Gene

ENSMUSG00000001260

Gene Name

gamma-aminobutyric acid (GABA) A receptor, subunit gamma 1

Synonyms

GabaA

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.056) question?

Stock #

R7671 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

70751047-70842617 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 70815980 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 77 (N77I)

Ref Sequence

ENSEMBL: ENSMUSP00000031119 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031119] [ENSMUST00000199705]

Predicted Effect

probably damaging
Transcript: ENSMUST00000031119
AA Change: N77I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000031119
Gene: ENSMUSG00000001260
AA Change: N77I

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	40	46	N/A	INTRINSIC
Pfam:Neur_chan_LBD	64	270	7e-51	PFAM
Pfam:Neur_chan_memb	277	378	2.3e-36	PFAM
low complexity region	411	422	N/A	INTRINSIC
transmembrane domain	441	463	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000199705
AA Change: N72I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000142454
Gene: ENSMUSG00000001260
AA Change: N72I

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
low complexity region	35	41	N/A	INTRINSIC
Pfam:Neur_chan_LBD	59	265	1.7e-50	PFAM
Pfam:Neur_chan_memb	272	304	9.5e-12	PFAM
low complexity region	365	376	N/A	INTRINSIC
transmembrane domain	395	417	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ligand-gated ionic channel family. It is an integral membrane protein and plays an important role in inhibiting neurotransmission by binding to the benzodiazepine receptor and opening an integral chloride channel. This gene is clustered with three other family members on chromosome 4. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	T	A	18: 38,259,925	I394N	probably damaging	Het
4930435E12Rik	C	T	16: 38,828,091	D219N	possibly damaging	Het
4932438A13Rik	T	C	3: 36,943,231	F1146L	probably damaging	Het
4933406M09Rik	T	C	1: 134,390,062	C191R	probably benign	Het
Akap13	C	A	7: 75,569,900	T17K	probably damaging	Het
Ankrd29	T	A	18: 12,260,986	K257I	probably damaging	Het
Bicc1	A	G	10: 70,957,167	L219P	probably benign	Het
Boc	C	T	16: 44,491,849	V617M		Het
Ccl8	A	G	11: 82,115,207		probably benign	Het
Col18a1	A	G	10: 77,085,383	L261P	unknown	Het
Col5a3	T	A	9: 20,775,086		probably null	Het
Cryba4	A	C	5: 112,248,173		probably null	Het
Csf2rb	A	G	15: 78,338,930	Y114C	probably damaging	Het
Ctif	T	C	18: 75,472,016	D484G	probably damaging	Het
Ctnnal1	A	G	4: 56,837,848	F261L	probably damaging	Het
Defb22	A	T	2: 152,486,030	N78K	unknown	Het
Efr3a	G	A	15: 65,837,434		probably null	Het
Elp4	G	T	2: 105,904,481	A3E	probably damaging	Het
Emilin2	A	G	17: 71,273,910	V607A	probably benign	Het
Epsti1	A	G	14: 77,904,490	Y2C	probably damaging	Het
Fam81b	A	C	13: 76,271,293	L46R	probably damaging	Het
Fam81b	G	T	13: 76,271,294	L46I	possibly damaging	Het
Fbxo15	T	A	18: 84,964,153	H288Q	probably damaging	Het
Ganab	A	G	19: 8,912,852	Y715C	possibly damaging	Het
Hist3h2ba	T	C	11: 58,949,276	S113P	possibly damaging	Het
Iqgap2	T	C	13: 95,628,119	D1539G	probably damaging	Het
Kcp	T	C	6: 29,496,517	N633S	probably benign	Het
Krt6a	C	A	15: 101,690,543	S529I	unknown	Het
Leo1	A	G	9: 75,445,562	H129R	probably benign	Het
Lmf1	G	A	17: 25,579,349	V55M	possibly damaging	Het
Mcm9	A	G	10: 53,537,569	S472P	probably benign	Het
Med27	T	A	2: 29,377,938	V33D		Het
Mup15	C	T	4: 61,438,289	E80K	probably benign	Het
Myo18a	G	A	11: 77,859,420	R199H		Het
Nebl	T	A	2: 17,390,916	R558*	probably null	Het
Olfr1121	A	G	2: 87,372,269	T246A	probably damaging	Het
Olfr1252	A	T	2: 89,721,259	I284K	probably damaging	Het
Olfr1329	A	T	4: 118,916,986	H160Q	probably benign	Het
Olfr506	T	C	7: 108,612,991	I228T	probably damaging	Het
Olfr740	G	T	14: 50,453,885	V278L	probably benign	Het
Olfr815	T	C	10: 129,902,353	D119G	probably damaging	Het
Olfr890	A	T	9: 38,143,440	M97L	probably benign	Het
Pde11a	A	T	2: 76,215,353	F376I	possibly damaging	Het
Prima1	A	T	12: 103,235,661	C52S	probably damaging	Het
Pxn	G	A	5: 115,548,547	R366H	not run	Het
Sgce	T	C	6: 4,691,564	Y337C	probably damaging	Het
Slc25a10	T	A	11: 120,495,460	M130K	probably benign	Het
Slc29a2	A	T	19: 5,024,262	N5I	probably benign	Het
Slc35a1	A	T	4: 34,673,875	H150Q		Het
Slc5a4a	T	A	10: 76,147,550	V7D	unknown	Het
Stk17b	T	A	1: 53,766,000	D134V	probably damaging	Het
Thbs3	T	A	3: 89,216,707	S36T	probably benign	Het
Thsd4	A	G	9: 60,428,174	S152P	probably benign	Het
Tmem67	G	T	4: 12,063,698	H422N	probably benign	Het
Tram1	C	A	1: 13,589,644	V27F	probably damaging	Het
Trim14	A	G	4: 46,507,238	V326A	possibly damaging	Het

Other mutations in Gabrg1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00715:Gabrg1	APN	5	70815955	critical splice donor site	probably null
IGL00798:Gabrg1	APN	5	70782283	missense	probably damaging	1.00
IGL01012:Gabrg1	APN	5	70778169	missense	probably benign	0.03
IGL01597:Gabrg1	APN	5	70782348	missense	probably damaging	1.00
IGL01637:Gabrg1	APN	5	70777205	missense	probably damaging	1.00
IGL02589:Gabrg1	APN	5	70842152	nonsense	probably null
IGL03031:Gabrg1	APN	5	70794682	nonsense	probably null
IGL03346:Gabrg1	APN	5	70778131	missense	possibly damaging	0.89
PIT4260001:Gabrg1	UTSW	5	70782280	missense	probably benign	0.01
R0197:Gabrg1	UTSW	5	70774389	missense	probably damaging	1.00
R1271:Gabrg1	UTSW	5	70777144	missense	probably damaging	0.98
R1795:Gabrg1	UTSW	5	70782253	missense	possibly damaging	0.83
R1817:Gabrg1	UTSW	5	70754251	missense	probably benign	0.08
R1820:Gabrg1	UTSW	5	70774413	missense	probably damaging	1.00
R2254:Gabrg1	UTSW	5	70782364	nonsense	probably null
R4566:Gabrg1	UTSW	5	70842141	missense	probably benign	0.01
R4768:Gabrg1	UTSW	5	70754173	missense	probably damaging	0.99
R4976:Gabrg1	UTSW	5	70774411	missense	possibly damaging	0.95
R5104:Gabrg1	UTSW	5	70774432	missense	probably damaging	1.00
R6062:Gabrg1	UTSW	5	70780713	missense	probably damaging	1.00
R6086:Gabrg1	UTSW	5	70754053	missense	probably damaging	1.00
R6148:Gabrg1	UTSW	5	70774461	missense	probably damaging	1.00
R6234:Gabrg1	UTSW	5	70842141	missense	probably benign	0.01
R6724:Gabrg1	UTSW	5	70754209	missense	possibly damaging	0.80
R6786:Gabrg1	UTSW	5	70754267	missense	probably benign	0.00
R6794:Gabrg1	UTSW	5	70815971	missense	probably damaging	1.00
R7209:Gabrg1	UTSW	5	70754170	missense	probably damaging	0.98
R7654:Gabrg1	UTSW	5	70778161	missense	probably benign	0.44
R7844:Gabrg1	UTSW	5	70774332	missense	probably damaging	1.00
R7877:Gabrg1	UTSW	5	70816072	missense	probably damaging	0.99
R8219:Gabrg1	UTSW	5	70774300	nonsense	probably null
X0027:Gabrg1	UTSW	5	70754261	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCCTCTCTGACCATGAACTCTAAG -3'
(R):5'- ATATCTGAACAAGTCTAGGGAGC -3'

Sequencing Primer
(F):5'- TGACCATGAACTCTAAGATTCTGACC -3'
(R):5'- CTGAACAAGTCTAGGGAGCAATATTC -3'

Posted On

2019-11-12