Incidental Mutation 'R7671:Gabrg1'
ID592155
Institutional Source Beutler Lab
Gene Symbol Gabrg1
Ensembl Gene ENSMUSG00000001260
Gene Namegamma-aminobutyric acid (GABA) A receptor, subunit gamma 1
SynonymsGabaA
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R7671 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location70751047-70842617 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70815980 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 77 (N77I)
Ref Sequence ENSEMBL: ENSMUSP00000031119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031119] [ENSMUST00000199705]
Predicted Effect probably damaging
Transcript: ENSMUST00000031119
AA Change: N77I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031119
Gene: ENSMUSG00000001260
AA Change: N77I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 40 46 N/A INTRINSIC
Pfam:Neur_chan_LBD 64 270 7e-51 PFAM
Pfam:Neur_chan_memb 277 378 2.3e-36 PFAM
low complexity region 411 422 N/A INTRINSIC
transmembrane domain 441 463 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000199705
AA Change: N72I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142454
Gene: ENSMUSG00000001260
AA Change: N72I

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 35 41 N/A INTRINSIC
Pfam:Neur_chan_LBD 59 265 1.7e-50 PFAM
Pfam:Neur_chan_memb 272 304 9.5e-12 PFAM
low complexity region 365 376 N/A INTRINSIC
transmembrane domain 395 417 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ligand-gated ionic channel family. It is an integral membrane protein and plays an important role in inhibiting neurotransmission by binding to the benzodiazepine receptor and opening an integral chloride channel. This gene is clustered with three other family members on chromosome 4. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T A 18: 38,259,925 I394N probably damaging Het
4930435E12Rik C T 16: 38,828,091 D219N possibly damaging Het
4932438A13Rik T C 3: 36,943,231 F1146L probably damaging Het
4933406M09Rik T C 1: 134,390,062 C191R probably benign Het
Akap13 C A 7: 75,569,900 T17K probably damaging Het
Ankrd29 T A 18: 12,260,986 K257I probably damaging Het
Bicc1 A G 10: 70,957,167 L219P probably benign Het
Boc C T 16: 44,491,849 V617M Het
Ccl8 A G 11: 82,115,207 probably benign Het
Col18a1 A G 10: 77,085,383 L261P unknown Het
Col5a3 T A 9: 20,775,086 probably null Het
Cryba4 A C 5: 112,248,173 probably null Het
Csf2rb A G 15: 78,338,930 Y114C probably damaging Het
Ctif T C 18: 75,472,016 D484G probably damaging Het
Ctnnal1 A G 4: 56,837,848 F261L probably damaging Het
Defb22 A T 2: 152,486,030 N78K unknown Het
Efr3a G A 15: 65,837,434 probably null Het
Elp4 G T 2: 105,904,481 A3E probably damaging Het
Emilin2 A G 17: 71,273,910 V607A probably benign Het
Epsti1 A G 14: 77,904,490 Y2C probably damaging Het
Fam81b A C 13: 76,271,293 L46R probably damaging Het
Fam81b G T 13: 76,271,294 L46I possibly damaging Het
Fbxo15 T A 18: 84,964,153 H288Q probably damaging Het
Ganab A G 19: 8,912,852 Y715C possibly damaging Het
Hist3h2ba T C 11: 58,949,276 S113P possibly damaging Het
Iqgap2 T C 13: 95,628,119 D1539G probably damaging Het
Kcp T C 6: 29,496,517 N633S probably benign Het
Krt6a C A 15: 101,690,543 S529I unknown Het
Leo1 A G 9: 75,445,562 H129R probably benign Het
Lmf1 G A 17: 25,579,349 V55M possibly damaging Het
Mcm9 A G 10: 53,537,569 S472P probably benign Het
Med27 T A 2: 29,377,938 V33D Het
Mup15 C T 4: 61,438,289 E80K probably benign Het
Myo18a G A 11: 77,859,420 R199H Het
Nebl T A 2: 17,390,916 R558* probably null Het
Olfr1121 A G 2: 87,372,269 T246A probably damaging Het
Olfr1252 A T 2: 89,721,259 I284K probably damaging Het
Olfr1329 A T 4: 118,916,986 H160Q probably benign Het
Olfr506 T C 7: 108,612,991 I228T probably damaging Het
Olfr740 G T 14: 50,453,885 V278L probably benign Het
Olfr815 T C 10: 129,902,353 D119G probably damaging Het
Olfr890 A T 9: 38,143,440 M97L probably benign Het
Pde11a A T 2: 76,215,353 F376I possibly damaging Het
Prima1 A T 12: 103,235,661 C52S probably damaging Het
Pxn G A 5: 115,548,547 R366H not run Het
Sgce T C 6: 4,691,564 Y337C probably damaging Het
Slc25a10 T A 11: 120,495,460 M130K probably benign Het
Slc29a2 A T 19: 5,024,262 N5I probably benign Het
Slc35a1 A T 4: 34,673,875 H150Q Het
Slc5a4a T A 10: 76,147,550 V7D unknown Het
Stk17b T A 1: 53,766,000 D134V probably damaging Het
Thbs3 T A 3: 89,216,707 S36T probably benign Het
Thsd4 A G 9: 60,428,174 S152P probably benign Het
Tmem67 G T 4: 12,063,698 H422N probably benign Het
Tram1 C A 1: 13,589,644 V27F probably damaging Het
Trim14 A G 4: 46,507,238 V326A possibly damaging Het
Other mutations in Gabrg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Gabrg1 APN 5 70815955 critical splice donor site probably null
IGL00798:Gabrg1 APN 5 70782283 missense probably damaging 1.00
IGL01012:Gabrg1 APN 5 70778169 missense probably benign 0.03
IGL01597:Gabrg1 APN 5 70782348 missense probably damaging 1.00
IGL01637:Gabrg1 APN 5 70777205 missense probably damaging 1.00
IGL02589:Gabrg1 APN 5 70842152 nonsense probably null
IGL03031:Gabrg1 APN 5 70794682 nonsense probably null
IGL03346:Gabrg1 APN 5 70778131 missense possibly damaging 0.89
PIT4260001:Gabrg1 UTSW 5 70782280 missense probably benign 0.01
R0197:Gabrg1 UTSW 5 70774389 missense probably damaging 1.00
R1271:Gabrg1 UTSW 5 70777144 missense probably damaging 0.98
R1795:Gabrg1 UTSW 5 70782253 missense possibly damaging 0.83
R1817:Gabrg1 UTSW 5 70754251 missense probably benign 0.08
R1820:Gabrg1 UTSW 5 70774413 missense probably damaging 1.00
R2254:Gabrg1 UTSW 5 70782364 nonsense probably null
R4566:Gabrg1 UTSW 5 70842141 missense probably benign 0.01
R4768:Gabrg1 UTSW 5 70754173 missense probably damaging 0.99
R4976:Gabrg1 UTSW 5 70774411 missense possibly damaging 0.95
R5104:Gabrg1 UTSW 5 70774432 missense probably damaging 1.00
R6062:Gabrg1 UTSW 5 70780713 missense probably damaging 1.00
R6086:Gabrg1 UTSW 5 70754053 missense probably damaging 1.00
R6148:Gabrg1 UTSW 5 70774461 missense probably damaging 1.00
R6234:Gabrg1 UTSW 5 70842141 missense probably benign 0.01
R6724:Gabrg1 UTSW 5 70754209 missense possibly damaging 0.80
R6786:Gabrg1 UTSW 5 70754267 missense probably benign 0.00
R6794:Gabrg1 UTSW 5 70815971 missense probably damaging 1.00
R7209:Gabrg1 UTSW 5 70754170 missense probably damaging 0.98
R7654:Gabrg1 UTSW 5 70778161 missense probably benign 0.44
R7844:Gabrg1 UTSW 5 70774332 missense probably damaging 1.00
R7877:Gabrg1 UTSW 5 70816072 missense probably damaging 0.99
R8219:Gabrg1 UTSW 5 70774300 nonsense probably null
X0027:Gabrg1 UTSW 5 70754261 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCTCTCTGACCATGAACTCTAAG -3'
(R):5'- ATATCTGAACAAGTCTAGGGAGC -3'

Sequencing Primer
(F):5'- TGACCATGAACTCTAAGATTCTGACC -3'
(R):5'- CTGAACAAGTCTAGGGAGCAATATTC -3'
Posted On2019-11-12