Mutagenetix > Incidental Mutation

Incidental Mutation 'R7671:Kcp'

592159

Institutional Source

Beutler Lab

Gene Symbol

Kcp

Ensembl Gene

ENSMUSG00000059022

Gene Name

kielin/chordin-like protein

Synonyms

Crim2, KCP, LOC333088

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.145) question?

Stock #

R7671 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

29473162-29507952 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 29496517 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 633 (N633S)

Ref Sequence

ENSEMBL: ENSMUSP00000099135 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078112] [ENSMUST00000091391] [ENSMUST00000101614] [ENSMUST00000159479]

AlphaFold

Q3U492

Predicted Effect

probably benign
Transcript: ENSMUST00000078112
AA Change: N633S

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000077251
Gene: ENSMUSG00000059022
AA Change: N633S

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
SCOP:d1fxkc_	64	91	7e-3	SMART
VWC	136	190	1.41e-13	SMART
VWC	194	250	1.24e-9	SMART
VWC	255	311	4.55e-8	SMART
VWC	314	369	8.88e-11	SMART
VWC	428	484	9.15e-13	SMART
VWC	487	543	7.61e-10	SMART
VWC	546	601	4.05e-5	SMART
VWC	604	660	8.28e-11	SMART
VWC	667	723	6.58e-5	SMART
VWC	726	780	2.14e-4	SMART
VWC	783	839	1.98e-8	SMART
VWC	842	898	1.35e-1	SMART
VWC	901	957	5.77e-10	SMART
VWC	960	1015	1.21e-3	SMART
VWC	1018	1083	2.44e-8	SMART
VWC	1090	1143	1.05e-3	SMART
VWC	1150	1207	2.93e-11	SMART
Pfam:VWD	1214	1254	4.9e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000091391
AA Change: N633S

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000088954
Gene: ENSMUSG00000059022
AA Change: N633S

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
SCOP:d1fxkc_	64	91	7e-3	SMART
VWC	136	190	1.41e-13	SMART
VWC	194	250	1.24e-9	SMART
VWC	255	311	4.55e-8	SMART
VWC	314	369	8.88e-11	SMART
VWC	428	484	9.15e-13	SMART
VWC	487	543	7.61e-10	SMART
VWC	546	601	4.05e-5	SMART
VWC	604	660	8.28e-11	SMART
VWC	667	723	6.58e-5	SMART
VWC	726	780	2.14e-4	SMART
VWC	783	839	1.98e-8	SMART
VWC	842	898	1.35e-1	SMART
VWC	901	957	5.77e-10	SMART
VWC	960	1015	1.21e-3	SMART
VWC	1018	1082	6.53e-9	SMART
VWC	1089	1142	1.05e-3	SMART
VWC	1149	1206	2.93e-11	SMART
Pfam:VWD	1213	1253	4.6e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000101614
AA Change: N633S

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000099135
Gene: ENSMUSG00000059022
AA Change: N633S

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
SCOP:d1fxkc_	64	91	8e-3	SMART
VWC	136	190	1.41e-13	SMART
VWC	194	250	1.24e-9	SMART
VWC	255	311	4.55e-8	SMART
VWC	314	369	8.88e-11	SMART
VWC	428	484	9.15e-13	SMART
VWC	487	543	7.61e-10	SMART
VWC	546	601	4.05e-5	SMART
VWC	604	660	8.28e-11	SMART
VWC	667	723	6.58e-5	SMART
VWC	726	780	2.14e-4	SMART
VWC	783	839	1.98e-8	SMART
VWC	842	898	1.35e-1	SMART
VWC	901	957	5.77e-10	SMART
VWC	960	1015	1.21e-3	SMART
VWC	1018	1083	2.44e-8	SMART
VWC	1090	1143	1.05e-3	SMART
VWC	1150	1207	2.93e-11	SMART
VWD	1201	1362	6.09e-50	SMART
C8	1404	1479	1.55e-34	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000159479

SMART Domains

Protein: ENSMUSP00000124771
Gene: ENSMUSG00000059022

Domain	Start	End	E-Value	Type
VWC	1	51	4.56e-1	SMART
VWC	54	110	1.98e-8	SMART
VWC	113	169	1.35e-1	SMART
VWC	172	228	5.77e-10	SMART
VWC	231	286	1.21e-3	SMART
VWC	289	353	6.53e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000160181

SMART Domains

Protein: ENSMUSP00000125699
Gene: ENSMUSG00000059022

Domain	Start	End	E-Value	Type
VWC	18	74	1.24e-9	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous null mice display increased sensitivity to renal injury. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	T	A	18: 38,259,925	I394N	probably damaging	Het
4930435E12Rik	C	T	16: 38,828,091	D219N	possibly damaging	Het
4932438A13Rik	T	C	3: 36,943,231	F1146L	probably damaging	Het
4933406M09Rik	T	C	1: 134,390,062	C191R	probably benign	Het
Akap13	C	A	7: 75,569,900	T17K	probably damaging	Het
Ankrd29	T	A	18: 12,260,986	K257I	probably damaging	Het
Bicc1	A	G	10: 70,957,167	L219P	probably benign	Het
Boc	C	T	16: 44,491,849	V617M		Het
Ccl8	A	G	11: 82,115,207		probably benign	Het
Col18a1	A	G	10: 77,085,383	L261P	unknown	Het
Col5a3	T	A	9: 20,775,086		probably null	Het
Cryba4	A	C	5: 112,248,173		probably null	Het
Csf2rb	A	G	15: 78,338,930	Y114C	probably damaging	Het
Ctif	T	C	18: 75,472,016	D484G	probably damaging	Het
Ctnnal1	A	G	4: 56,837,848	F261L	probably damaging	Het
Defb22	A	T	2: 152,486,030	N78K	unknown	Het
Efr3a	G	A	15: 65,837,434		probably null	Het
Elp4	G	T	2: 105,904,481	A3E	probably damaging	Het
Emilin2	A	G	17: 71,273,910	V607A	probably benign	Het
Epsti1	A	G	14: 77,904,490	Y2C	probably damaging	Het
Fam81b	A	C	13: 76,271,293	L46R	probably damaging	Het
Fam81b	G	T	13: 76,271,294	L46I	possibly damaging	Het
Fbxo15	T	A	18: 84,964,153	H288Q	probably damaging	Het
Gabrg1	T	A	5: 70,815,980	N77I	probably damaging	Het
Ganab	A	G	19: 8,912,852	Y715C	possibly damaging	Het
Hist3h2ba	T	C	11: 58,949,276	S113P	possibly damaging	Het
Iqgap2	T	C	13: 95,628,119	D1539G	probably damaging	Het
Krt6a	C	A	15: 101,690,543	S529I	unknown	Het
Leo1	A	G	9: 75,445,562	H129R	probably benign	Het
Lmf1	G	A	17: 25,579,349	V55M	possibly damaging	Het
Mcm9	A	G	10: 53,537,569	S472P	probably benign	Het
Med27	T	A	2: 29,377,938	V33D		Het
Mup15	C	T	4: 61,438,289	E80K	probably benign	Het
Myo18a	G	A	11: 77,859,420	R199H		Het
Nebl	T	A	2: 17,390,916	R558*	probably null	Het
Olfr1121	A	G	2: 87,372,269	T246A	probably damaging	Het
Olfr1252	A	T	2: 89,721,259	I284K	probably damaging	Het
Olfr1329	A	T	4: 118,916,986	H160Q	probably benign	Het
Olfr506	T	C	7: 108,612,991	I228T	probably damaging	Het
Olfr740	G	T	14: 50,453,885	V278L	probably benign	Het
Olfr815	T	C	10: 129,902,353	D119G	probably damaging	Het
Olfr890	A	T	9: 38,143,440	M97L	probably benign	Het
Pde11a	A	T	2: 76,215,353	F376I	possibly damaging	Het
Prima1	A	T	12: 103,235,661	C52S	probably damaging	Het
Pxn	G	A	5: 115,548,547	R366H	not run	Het
Sgce	T	C	6: 4,691,564	Y337C	probably damaging	Het
Slc25a10	T	A	11: 120,495,460	M130K	probably benign	Het
Slc29a2	A	T	19: 5,024,262	N5I	probably benign	Het
Slc35a1	A	T	4: 34,673,875	H150Q		Het
Slc5a4a	T	A	10: 76,147,550	V7D	unknown	Het
Stk17b	T	A	1: 53,766,000	D134V	probably damaging	Het
Thbs3	T	A	3: 89,216,707	S36T	probably benign	Het
Thsd4	A	G	9: 60,428,174	S152P	probably benign	Het
Tmem67	G	T	4: 12,063,698	H422N	probably benign	Het
Tram1	C	A	1: 13,589,644	V27F	probably damaging	Het
Trim14	A	G	4: 46,507,238	V326A	possibly damaging	Het

Other mutations in Kcp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00474:Kcp	APN	6	29482657	missense	probably benign
IGL01344:Kcp	APN	6	29498951	splice site	probably null
IGL01404:Kcp	APN	6	29496639	missense	probably damaging	0.99
IGL01735:Kcp	APN	6	29498879	missense	probably damaging	1.00
IGL01776:Kcp	APN	6	29497908	missense	probably damaging	1.00
IGL02092:Kcp	APN	6	29489032	critical splice donor site	probably null
IGL02252:Kcp	APN	6	29504549	missense	probably damaging	1.00
IGL02690:Kcp	APN	6	29484999	unclassified	probably benign
IGL02817:Kcp	APN	6	29496969	missense	probably damaging	0.97
IGL03074:Kcp	APN	6	29496631	missense	probably damaging	1.00
P0045:Kcp	UTSW	6	29498348	missense	probably damaging	1.00
R0219:Kcp	UTSW	6	29495785	missense	probably damaging	1.00
R0355:Kcp	UTSW	6	29496927	missense	possibly damaging	0.89
R0738:Kcp	UTSW	6	29490439	missense	probably benign	0.24
R1111:Kcp	UTSW	6	29485423	missense	probably benign
R1304:Kcp	UTSW	6	29501292	unclassified	probably benign
R1663:Kcp	UTSW	6	29498965	missense	possibly damaging	0.68
R1808:Kcp	UTSW	6	29505655	missense	probably benign	0.05
R1907:Kcp	UTSW	6	29497835	unclassified	probably benign
R2030:Kcp	UTSW	6	29489072	missense	probably damaging	1.00
R2099:Kcp	UTSW	6	29496165	nonsense	probably null
R3411:Kcp	UTSW	6	29482846	missense	possibly damaging	0.68
R3982:Kcp	UTSW	6	29484637	missense	probably damaging	1.00
R3983:Kcp	UTSW	6	29484637	missense	probably damaging	1.00
R4223:Kcp	UTSW	6	29482258	missense	possibly damaging	0.55
R4377:Kcp	UTSW	6	29493203	missense	probably damaging	1.00
R4570:Kcp	UTSW	6	29491848	nonsense	probably null
R4624:Kcp	UTSW	6	29482814	missense	possibly damaging	0.94
R4694:Kcp	UTSW	6	29493197	missense	probably benign	0.29
R4750:Kcp	UTSW	6	29484626	missense	probably benign	0.03
R4968:Kcp	UTSW	6	29497629	nonsense	probably null
R5053:Kcp	UTSW	6	29496958	missense	probably benign	0.01
R5067:Kcp	UTSW	6	29492108	missense	probably benign	0.06
R5253:Kcp	UTSW	6	29498520	unclassified	probably benign
R5418:Kcp	UTSW	6	29504284	nonsense	probably null
R6020:Kcp	UTSW	6	29502864	missense	probably benign	0.03
R6033:Kcp	UTSW	6	29493194	missense	probably damaging	1.00
R6033:Kcp	UTSW	6	29493194	missense	probably damaging	1.00
R6088:Kcp	UTSW	6	29502632	missense	probably benign
R6178:Kcp	UTSW	6	29482888	missense	possibly damaging	0.68
R6285:Kcp	UTSW	6	29502365	missense	probably benign	0.21
R6310:Kcp	UTSW	6	29493258	missense	probably damaging	0.98
R6369:Kcp	UTSW	6	29484694	missense	probably damaging	1.00
R6860:Kcp	UTSW	6	29505720	missense	probably benign	0.19
R6949:Kcp	UTSW	6	29484612	splice site	probably null
R6962:Kcp	UTSW	6	29482840	missense	probably benign	0.08
R7006:Kcp	UTSW	6	29499170	missense	probably damaging	1.00
R7138:Kcp	UTSW	6	29491862	nonsense	probably null
R7141:Kcp	UTSW	6	29487512	nonsense	probably null
R7153:Kcp	UTSW	6	29499015	missense	probably damaging	1.00
R7162:Kcp	UTSW	6	29497200	splice site	probably null
R7334:Kcp	UTSW	6	29485512	missense	probably damaging	1.00
R7565:Kcp	UTSW	6	29499187	missense	probably damaging	1.00
R7766:Kcp	UTSW	6	29496847	missense	probably damaging	0.98
R7781:Kcp	UTSW	6	29497765	missense	probably damaging	1.00
R8702:Kcp	UTSW	6	29482751	missense	probably damaging	1.00
R9384:Kcp	UTSW	6	29496619	critical splice donor site	probably null
R9425:Kcp	UTSW	6	29489152	missense	probably benign
R9553:Kcp	UTSW	6	29485101	missense	probably null	1.00
Z1176:Kcp	UTSW	6	29485012	missense	probably benign	0.23
Z1177:Kcp	UTSW	6	29485525	missense	probably benign	0.45

Predicted Primers

PCR Primer
(F):5'- ACCATATTCCCTGACTGTGGG -3'
(R):5'- TGCAAGAATGACTGCACAGG -3'

Sequencing Primer
(F):5'- AGTCAGCAGGGGCATCTG -3'
(R):5'- TGTACCTGGCATGGAGGACTC -3'

Posted On

2019-11-12