Incidental Mutation 'R7671:Col5a3'
ID 592162
Institutional Source Beutler Lab
Gene Symbol Col5a3
Ensembl Gene ENSMUSG00000004098
Gene Name collagen, type V, alpha 3
Synonyms Pro-alpha3(V)
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.398) question?
Stock # R7671 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 20681353-20726363 bp(-) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) T to A at 20686382 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000004201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004201] [ENSMUST00000004201] [ENSMUST00000004201]
AlphaFold Q9JLI2
Predicted Effect probably null
Transcript: ENSMUST00000004201
SMART Domains Protein: ENSMUSP00000004201
Gene: ENSMUSG00000004098

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
TSPN 32 211 7.08e-28 SMART
LamG 89 210 2.13e-2 SMART
low complexity region 247 267 N/A INTRINSIC
low complexity region 295 314 N/A INTRINSIC
low complexity region 341 347 N/A INTRINSIC
low complexity region 369 381 N/A INTRINSIC
low complexity region 391 434 N/A INTRINSIC
low complexity region 461 474 N/A INTRINSIC
Pfam:Collagen 475 538 5.5e-10 PFAM
low complexity region 597 616 N/A INTRINSIC
low complexity region 628 694 N/A INTRINSIC
internal_repeat_3 703 737 7.13e-16 PROSPERO
low complexity region 742 821 N/A INTRINSIC
low complexity region 823 844 N/A INTRINSIC
low complexity region 859 889 N/A INTRINSIC
internal_repeat_2 892 1081 5.05e-17 PROSPERO
internal_repeat_1 996 1133 7.47e-22 PROSPERO
internal_repeat_3 1105 1139 7.13e-16 PROSPERO
low complexity region 1140 1165 N/A INTRINSIC
low complexity region 1168 1255 N/A INTRINSIC
low complexity region 1258 1282 N/A INTRINSIC
low complexity region 1285 1306 N/A INTRINSIC
low complexity region 1311 1418 N/A INTRINSIC
Pfam:Collagen 1429 1491 9.5e-10 PFAM
COLFI 1508 1738 7.98e-92 SMART
Predicted Effect probably null
Transcript: ENSMUST00000004201
SMART Domains Protein: ENSMUSP00000004201
Gene: ENSMUSG00000004098

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
TSPN 32 211 7.08e-28 SMART
LamG 89 210 2.13e-2 SMART
low complexity region 247 267 N/A INTRINSIC
low complexity region 295 314 N/A INTRINSIC
low complexity region 341 347 N/A INTRINSIC
low complexity region 369 381 N/A INTRINSIC
low complexity region 391 434 N/A INTRINSIC
low complexity region 461 474 N/A INTRINSIC
Pfam:Collagen 475 538 5.5e-10 PFAM
low complexity region 597 616 N/A INTRINSIC
low complexity region 628 694 N/A INTRINSIC
internal_repeat_3 703 737 7.13e-16 PROSPERO
low complexity region 742 821 N/A INTRINSIC
low complexity region 823 844 N/A INTRINSIC
low complexity region 859 889 N/A INTRINSIC
internal_repeat_2 892 1081 5.05e-17 PROSPERO
internal_repeat_1 996 1133 7.47e-22 PROSPERO
internal_repeat_3 1105 1139 7.13e-16 PROSPERO
low complexity region 1140 1165 N/A INTRINSIC
low complexity region 1168 1255 N/A INTRINSIC
low complexity region 1258 1282 N/A INTRINSIC
low complexity region 1285 1306 N/A INTRINSIC
low complexity region 1311 1418 N/A INTRINSIC
Pfam:Collagen 1429 1491 9.5e-10 PFAM
COLFI 1508 1738 7.98e-92 SMART
Predicted Effect probably null
Transcript: ENSMUST00000004201
SMART Domains Protein: ENSMUSP00000004201
Gene: ENSMUSG00000004098

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
TSPN 32 211 7.08e-28 SMART
LamG 89 210 2.13e-2 SMART
low complexity region 247 267 N/A INTRINSIC
low complexity region 295 314 N/A INTRINSIC
low complexity region 341 347 N/A INTRINSIC
low complexity region 369 381 N/A INTRINSIC
low complexity region 391 434 N/A INTRINSIC
low complexity region 461 474 N/A INTRINSIC
Pfam:Collagen 475 538 5.5e-10 PFAM
low complexity region 597 616 N/A INTRINSIC
low complexity region 628 694 N/A INTRINSIC
internal_repeat_3 703 737 7.13e-16 PROSPERO
low complexity region 742 821 N/A INTRINSIC
low complexity region 823 844 N/A INTRINSIC
low complexity region 859 889 N/A INTRINSIC
internal_repeat_2 892 1081 5.05e-17 PROSPERO
internal_repeat_1 996 1133 7.47e-22 PROSPERO
internal_repeat_3 1105 1139 7.13e-16 PROSPERO
low complexity region 1140 1165 N/A INTRINSIC
low complexity region 1168 1255 N/A INTRINSIC
low complexity region 1258 1282 N/A INTRINSIC
low complexity region 1285 1306 N/A INTRINSIC
low complexity region 1311 1418 N/A INTRINSIC
Pfam:Collagen 1429 1491 9.5e-10 PFAM
COLFI 1508 1738 7.98e-92 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha chain for one of the low abundance fibrillar collagens. Fibrillar collagen molecules are trimers that can be composed of one or more types of alpha chains. Type V collagen is found in tissues containing type I collagen and appears to regulate the assembly of heterotypic fibers composed of both type I and type V collagen. This gene product is closely related to type XI collagen and it is possible that the collagen chains of types V and XI constitute a single collagen type with tissue-specific chain combinations. Mutations in this gene are thought to be responsible for the symptoms of a subset of patients with Ehlers-Danlos syndrome type III. Messages of several sizes can be detected in northern blots but sequence information cannot confirm the identity of the shorter messages. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation show decreased pancreatic beta cell mass, hyperglycemia, hypoinsulinemia, impaired glucose tolerance, insulin resistance and impaired glucose uptake. Homozygous females show decreased susceptibility to diet-induced obesity and a thin hypodermal fat layer. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 C A 7: 75,219,648 (GRCm39) T17K probably damaging Het
Ankrd29 T A 18: 12,394,043 (GRCm39) K257I probably damaging Het
Bicc1 A G 10: 70,792,997 (GRCm39) L219P probably benign Het
Bltp1 T C 3: 36,997,380 (GRCm39) F1146L probably damaging Het
Boc C T 16: 44,312,212 (GRCm39) V617M Het
Ccl8 A G 11: 82,006,033 (GRCm39) probably benign Het
Col18a1 A G 10: 76,921,217 (GRCm39) L261P unknown Het
Cryba4 A C 5: 112,396,039 (GRCm39) probably null Het
Csf2rb A G 15: 78,223,130 (GRCm39) Y114C probably damaging Het
Ctif T C 18: 75,605,087 (GRCm39) D484G probably damaging Het
Ctnnal1 A G 4: 56,837,848 (GRCm39) F261L probably damaging Het
Defb22 A T 2: 152,327,950 (GRCm39) N78K unknown Het
Dele1 T A 18: 38,392,978 (GRCm39) I394N probably damaging Het
Efr3a G A 15: 65,709,283 (GRCm39) probably null Het
Elp4 G T 2: 105,734,826 (GRCm39) A3E probably damaging Het
Emilin2 A G 17: 71,580,905 (GRCm39) V607A probably benign Het
Epsti1 A G 14: 78,141,930 (GRCm39) Y2C probably damaging Het
Fam81b A C 13: 76,419,412 (GRCm39) L46R probably damaging Het
Fam81b G T 13: 76,419,413 (GRCm39) L46I possibly damaging Het
Fbxo15 T A 18: 84,982,278 (GRCm39) H288Q probably damaging Het
Gabrg1 T A 5: 70,973,323 (GRCm39) N77I probably damaging Het
Ganab A G 19: 8,890,216 (GRCm39) Y715C possibly damaging Het
H2bc27 T C 11: 58,840,102 (GRCm39) S113P possibly damaging Het
Iqgap2 T C 13: 95,764,627 (GRCm39) D1539G probably damaging Het
Kcp T C 6: 29,496,516 (GRCm39) N633S probably benign Het
Krt6a C A 15: 101,598,978 (GRCm39) S529I unknown Het
Leo1 A G 9: 75,352,844 (GRCm39) H129R probably benign Het
Lmf1 G A 17: 25,798,323 (GRCm39) V55M possibly damaging Het
Mcm9 A G 10: 53,413,665 (GRCm39) S472P probably benign Het
Med27 T A 2: 29,267,950 (GRCm39) V33D Het
Mgat4f T C 1: 134,317,800 (GRCm39) C191R probably benign Het
Mup15 C T 4: 61,356,526 (GRCm39) E80K probably benign Het
Myo18a G A 11: 77,750,246 (GRCm39) R199H Het
Nebl T A 2: 17,395,727 (GRCm39) R558* probably null Het
Or10ak8 A T 4: 118,774,183 (GRCm39) H160Q probably benign Het
Or11g7 G T 14: 50,691,342 (GRCm39) V278L probably benign Het
Or12e9 A G 2: 87,202,613 (GRCm39) T246A probably damaging Het
Or4a79 A T 2: 89,551,603 (GRCm39) I284K probably damaging Het
Or5p78 T C 7: 108,212,198 (GRCm39) I228T probably damaging Het
Or6c217 T C 10: 129,738,222 (GRCm39) D119G probably damaging Het
Or8b41 A T 9: 38,054,736 (GRCm39) M97L probably benign Het
Pde11a A T 2: 76,045,697 (GRCm39) F376I possibly damaging Het
Prima1 A T 12: 103,201,920 (GRCm39) C52S probably damaging Het
Pxn G A 5: 115,686,606 (GRCm39) R366H not run Het
Sgce T C 6: 4,691,564 (GRCm39) Y337C probably damaging Het
Slc25a10 T A 11: 120,386,286 (GRCm39) M130K probably benign Het
Slc29a2 A T 19: 5,074,290 (GRCm39) N5I probably benign Het
Slc35a1 A T 4: 34,673,875 (GRCm39) H150Q Het
Slc5a4a T A 10: 75,983,384 (GRCm39) V7D unknown Het
Stk17b T A 1: 53,805,159 (GRCm39) D134V probably damaging Het
Tex55 C T 16: 38,648,453 (GRCm39) D219N possibly damaging Het
Thbs3 T A 3: 89,124,014 (GRCm39) S36T probably benign Het
Thsd4 A G 9: 60,335,457 (GRCm39) S152P probably benign Het
Tmem67 G T 4: 12,063,698 (GRCm39) H422N probably benign Het
Tram1 C A 1: 13,659,868 (GRCm39) V27F probably damaging Het
Trim14 A G 4: 46,507,238 (GRCm39) V326A possibly damaging Het
Other mutations in Col5a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Col5a3 APN 9 20,697,685 (GRCm39) nonsense probably null
IGL01548:Col5a3 APN 9 20,714,296 (GRCm39) splice site probably benign
IGL02164:Col5a3 APN 9 20,703,939 (GRCm39) critical splice donor site probably null
IGL02297:Col5a3 APN 9 20,683,450 (GRCm39) missense unknown
IGL02333:Col5a3 APN 9 20,710,602 (GRCm39) missense unknown
IGL02349:Col5a3 APN 9 20,683,657 (GRCm39) missense unknown
IGL02390:Col5a3 APN 9 20,688,292 (GRCm39) missense unknown
IGL02685:Col5a3 APN 9 20,683,501 (GRCm39) missense unknown
IGL02941:Col5a3 APN 9 20,715,962 (GRCm39) missense unknown
IGL03001:Col5a3 APN 9 20,719,040 (GRCm39) missense unknown
IGL03061:Col5a3 APN 9 20,708,868 (GRCm39) critical splice donor site probably null
IGL03102:Col5a3 APN 9 20,715,931 (GRCm39) critical splice donor site probably null
IGL03308:Col5a3 APN 9 20,719,675 (GRCm39) missense unknown
IGL03372:Col5a3 APN 9 20,686,624 (GRCm39) missense unknown
Guppy UTSW 9 20,690,329 (GRCm39) missense probably damaging 1.00
minifish UTSW 9 20,696,882 (GRCm39) missense probably damaging 0.99
R0002:Col5a3 UTSW 9 20,721,152 (GRCm39) critical splice acceptor site probably null
R0012:Col5a3 UTSW 9 20,688,404 (GRCm39) splice site probably benign
R0316:Col5a3 UTSW 9 20,686,621 (GRCm39) missense unknown
R0357:Col5a3 UTSW 9 20,719,064 (GRCm39) splice site probably benign
R0360:Col5a3 UTSW 9 20,683,762 (GRCm39) missense unknown
R0483:Col5a3 UTSW 9 20,693,777 (GRCm39) splice site probably null
R0485:Col5a3 UTSW 9 20,694,004 (GRCm39) missense probably damaging 0.99
R0627:Col5a3 UTSW 9 20,686,781 (GRCm39) missense unknown
R1035:Col5a3 UTSW 9 20,704,795 (GRCm39) splice site probably benign
R1051:Col5a3 UTSW 9 20,686,531 (GRCm39) missense unknown
R1295:Col5a3 UTSW 9 20,719,714 (GRCm39) missense unknown
R1438:Col5a3 UTSW 9 20,691,253 (GRCm39) missense probably damaging 0.99
R1622:Col5a3 UTSW 9 20,683,516 (GRCm39) missense unknown
R1668:Col5a3 UTSW 9 20,682,392 (GRCm39) missense unknown
R1680:Col5a3 UTSW 9 20,695,964 (GRCm39) critical splice donor site probably null
R2112:Col5a3 UTSW 9 20,721,073 (GRCm39) missense unknown
R2149:Col5a3 UTSW 9 20,682,566 (GRCm39) missense unknown
R2159:Col5a3 UTSW 9 20,682,606 (GRCm39) missense unknown
R2939:Col5a3 UTSW 9 20,706,954 (GRCm39) missense unknown
R3236:Col5a3 UTSW 9 20,718,949 (GRCm39) missense unknown
R3845:Col5a3 UTSW 9 20,719,673 (GRCm39) missense unknown
R4598:Col5a3 UTSW 9 20,685,855 (GRCm39) critical splice donor site probably null
R4599:Col5a3 UTSW 9 20,685,855 (GRCm39) critical splice donor site probably null
R4611:Col5a3 UTSW 9 20,726,192 (GRCm39) unclassified probably benign
R4713:Col5a3 UTSW 9 20,704,870 (GRCm39) missense unknown
R4723:Col5a3 UTSW 9 20,720,887 (GRCm39) missense unknown
R5209:Col5a3 UTSW 9 20,689,939 (GRCm39) intron probably benign
R5336:Col5a3 UTSW 9 20,710,597 (GRCm39) missense unknown
R5378:Col5a3 UTSW 9 20,708,872 (GRCm39) missense unknown
R5614:Col5a3 UTSW 9 20,694,772 (GRCm39) splice site probably benign
R5775:Col5a3 UTSW 9 20,712,368 (GRCm39) missense unknown
R5895:Col5a3 UTSW 9 20,683,738 (GRCm39) missense unknown
R6048:Col5a3 UTSW 9 20,718,915 (GRCm39) missense unknown
R6265:Col5a3 UTSW 9 20,705,060 (GRCm39) missense unknown
R6372:Col5a3 UTSW 9 20,696,882 (GRCm39) missense probably damaging 0.99
R6520:Col5a3 UTSW 9 20,685,348 (GRCm39) missense unknown
R6558:Col5a3 UTSW 9 20,690,329 (GRCm39) missense probably damaging 1.00
R6608:Col5a3 UTSW 9 20,685,315 (GRCm39) missense unknown
R6679:Col5a3 UTSW 9 20,690,329 (GRCm39) missense probably damaging 1.00
R6680:Col5a3 UTSW 9 20,690,329 (GRCm39) missense probably damaging 1.00
R6696:Col5a3 UTSW 9 20,690,329 (GRCm39) missense probably damaging 1.00
R6698:Col5a3 UTSW 9 20,690,329 (GRCm39) missense probably damaging 1.00
R6700:Col5a3 UTSW 9 20,690,329 (GRCm39) missense probably damaging 1.00
R6708:Col5a3 UTSW 9 20,686,331 (GRCm39) missense unknown
R6712:Col5a3 UTSW 9 20,690,329 (GRCm39) missense probably damaging 1.00
R6714:Col5a3 UTSW 9 20,690,329 (GRCm39) missense probably damaging 1.00
R6828:Col5a3 UTSW 9 20,709,748 (GRCm39) missense unknown
R7343:Col5a3 UTSW 9 20,705,242 (GRCm39) critical splice donor site probably null
R7431:Col5a3 UTSW 9 20,682,131 (GRCm39) makesense probably null
R7500:Col5a3 UTSW 9 20,711,585 (GRCm39) missense unknown
R7592:Col5a3 UTSW 9 20,708,689 (GRCm39) missense unknown
R7957:Col5a3 UTSW 9 20,685,347 (GRCm39) missense unknown
R8510:Col5a3 UTSW 9 20,705,028 (GRCm39) missense unknown
R8979:Col5a3 UTSW 9 20,686,597 (GRCm39) missense unknown
R9050:Col5a3 UTSW 9 20,697,691 (GRCm39) missense probably damaging 1.00
R9052:Col5a3 UTSW 9 20,710,733 (GRCm39) missense unknown
R9072:Col5a3 UTSW 9 20,682,453 (GRCm39) missense unknown
R9341:Col5a3 UTSW 9 20,704,909 (GRCm39) missense unknown
R9343:Col5a3 UTSW 9 20,704,909 (GRCm39) missense unknown
R9529:Col5a3 UTSW 9 20,685,308 (GRCm39) critical splice donor site probably null
R9562:Col5a3 UTSW 9 20,714,429 (GRCm39) missense unknown
R9781:Col5a3 UTSW 9 20,721,272 (GRCm39) missense unknown
Z1177:Col5a3 UTSW 9 20,686,630 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- ACCATCAAGATAGGGCCAATG -3'
(R):5'- ATTGGGCCTGATGGTCTTCC -3'

Sequencing Primer
(F):5'- CCATCTGTGTGAAGGGCCAATAC -3'
(R):5'- TGGTCTTCCAGGGATCCC -3'
Posted On 2019-11-12