Mutagenetix > Incidental Mutation

Incidental Mutation 'R7671:Col5a3'

592162

Institutional Source

Beutler Lab

Gene Symbol

Col5a3

Ensembl Gene

ENSMUSG00000004098

Gene Name

collagen, type V, alpha 3

Synonyms

Pro-alpha3(V)

Accession Numbers

Ncbi RefSeq: NM_016919.2; MGI:1858212

Essential gene?

Probably non essential (E-score: 0.218) question?

Stock #

R7671 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

20770050-20815067 bp(-) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

T to A at 20775086 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000004201 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004201] [ENSMUST00000004201] [ENSMUST00000004201]

AlphaFold

Q9JLI2

Predicted Effect

probably null
Transcript: ENSMUST00000004201

SMART Domains

Protein: ENSMUSP00000004201
Gene: ENSMUSG00000004098

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
TSPN	32	211	7.08e-28	SMART
LamG	89	210	2.13e-2	SMART
low complexity region	247	267	N/A	INTRINSIC
low complexity region	295	314	N/A	INTRINSIC
low complexity region	341	347	N/A	INTRINSIC
low complexity region	369	381	N/A	INTRINSIC
low complexity region	391	434	N/A	INTRINSIC
low complexity region	461	474	N/A	INTRINSIC
Pfam:Collagen	475	538	5.5e-10	PFAM
low complexity region	597	616	N/A	INTRINSIC
low complexity region	628	694	N/A	INTRINSIC
internal_repeat_3	703	737	7.13e-16	PROSPERO
low complexity region	742	821	N/A	INTRINSIC
low complexity region	823	844	N/A	INTRINSIC
low complexity region	859	889	N/A	INTRINSIC
internal_repeat_2	892	1081	5.05e-17	PROSPERO
internal_repeat_1	996	1133	7.47e-22	PROSPERO
internal_repeat_3	1105	1139	7.13e-16	PROSPERO
low complexity region	1140	1165	N/A	INTRINSIC
low complexity region	1168	1255	N/A	INTRINSIC
low complexity region	1258	1282	N/A	INTRINSIC
low complexity region	1285	1306	N/A	INTRINSIC
low complexity region	1311	1418	N/A	INTRINSIC
Pfam:Collagen	1429	1491	9.5e-10	PFAM
COLFI	1508	1738	7.98e-92	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000004201

SMART Domains

Protein: ENSMUSP00000004201
Gene: ENSMUSG00000004098

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
TSPN	32	211	7.08e-28	SMART
LamG	89	210	2.13e-2	SMART
low complexity region	247	267	N/A	INTRINSIC
low complexity region	295	314	N/A	INTRINSIC
low complexity region	341	347	N/A	INTRINSIC
low complexity region	369	381	N/A	INTRINSIC
low complexity region	391	434	N/A	INTRINSIC
low complexity region	461	474	N/A	INTRINSIC
Pfam:Collagen	475	538	5.5e-10	PFAM
low complexity region	597	616	N/A	INTRINSIC
low complexity region	628	694	N/A	INTRINSIC
internal_repeat_3	703	737	7.13e-16	PROSPERO
low complexity region	742	821	N/A	INTRINSIC
low complexity region	823	844	N/A	INTRINSIC
low complexity region	859	889	N/A	INTRINSIC
internal_repeat_2	892	1081	5.05e-17	PROSPERO
internal_repeat_1	996	1133	7.47e-22	PROSPERO
internal_repeat_3	1105	1139	7.13e-16	PROSPERO
low complexity region	1140	1165	N/A	INTRINSIC
low complexity region	1168	1255	N/A	INTRINSIC
low complexity region	1258	1282	N/A	INTRINSIC
low complexity region	1285	1306	N/A	INTRINSIC
low complexity region	1311	1418	N/A	INTRINSIC
Pfam:Collagen	1429	1491	9.5e-10	PFAM
COLFI	1508	1738	7.98e-92	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000004201

SMART Domains

Protein: ENSMUSP00000004201
Gene: ENSMUSG00000004098

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
TSPN	32	211	7.08e-28	SMART
LamG	89	210	2.13e-2	SMART
low complexity region	247	267	N/A	INTRINSIC
low complexity region	295	314	N/A	INTRINSIC
low complexity region	341	347	N/A	INTRINSIC
low complexity region	369	381	N/A	INTRINSIC
low complexity region	391	434	N/A	INTRINSIC
low complexity region	461	474	N/A	INTRINSIC
Pfam:Collagen	475	538	5.5e-10	PFAM
low complexity region	597	616	N/A	INTRINSIC
low complexity region	628	694	N/A	INTRINSIC
internal_repeat_3	703	737	7.13e-16	PROSPERO
low complexity region	742	821	N/A	INTRINSIC
low complexity region	823	844	N/A	INTRINSIC
low complexity region	859	889	N/A	INTRINSIC
internal_repeat_2	892	1081	5.05e-17	PROSPERO
internal_repeat_1	996	1133	7.47e-22	PROSPERO
internal_repeat_3	1105	1139	7.13e-16	PROSPERO
low complexity region	1140	1165	N/A	INTRINSIC
low complexity region	1168	1255	N/A	INTRINSIC
low complexity region	1258	1282	N/A	INTRINSIC
low complexity region	1285	1306	N/A	INTRINSIC
low complexity region	1311	1418	N/A	INTRINSIC
Pfam:Collagen	1429	1491	9.5e-10	PFAM
COLFI	1508	1738	7.98e-92	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

Strain: 5000519
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha chain for one of the low abundance fibrillar collagens. Fibrillar collagen molecules are trimers that can be composed of one or more types of alpha chains. Type V collagen is found in tissues containing type I collagen and appears to regulate the assembly of heterotypic fibers composed of both type I and type V collagen. This gene product is closely related to type XI collagen and it is possible that the collagen chains of types V and XI constitute a single collagen type with tissue-specific chain combinations. Mutations in this gene are thought to be responsible for the symptoms of a subset of patients with Ehlers-Danlos syndrome type III. Messages of several sizes can be detected in northern blots but sequence information cannot confirm the identity of the shorter messages. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation show decreased pancreatic beta cell mass, hyperglycemia, hypoinsulinemia, impaired glucose tolerance, insulin resistance and impaired glucose uptake. Homozygous females show decreased susceptibility to diet-induced obesity and a thin hypodermal fat layer. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	T	A	18: 38,259,925	I394N	probably damaging	Het
4930435E12Rik	C	T	16: 38,828,091	D219N	possibly damaging	Het
4932438A13Rik	T	C	3: 36,943,231	F1146L	probably damaging	Het
4933406M09Rik	T	C	1: 134,390,062	C191R	probably benign	Het
Akap13	C	A	7: 75,569,900	T17K	probably damaging	Het
Ankrd29	T	A	18: 12,260,986	K257I	probably damaging	Het
Bicc1	A	G	10: 70,957,167	L219P	probably benign	Het
Boc	C	T	16: 44,491,849	V617M		Het
Ccl8	A	G	11: 82,115,207		probably benign	Het
Col18a1	A	G	10: 77,085,383	L261P	unknown	Het
Cryba4	A	C	5: 112,248,173		probably null	Het
Csf2rb	A	G	15: 78,338,930	Y114C	probably damaging	Het
Ctif	T	C	18: 75,472,016	D484G	probably damaging	Het
Ctnnal1	A	G	4: 56,837,848	F261L	probably damaging	Het
Defb22	A	T	2: 152,486,030	N78K	unknown	Het
Efr3a	G	A	15: 65,837,434		probably null	Het
Elp4	G	T	2: 105,904,481	A3E	probably damaging	Het
Emilin2	A	G	17: 71,273,910	V607A	probably benign	Het
Epsti1	A	G	14: 77,904,490	Y2C	probably damaging	Het
Fam81b	A	C	13: 76,271,293	L46R	probably damaging	Het
Fam81b	G	T	13: 76,271,294	L46I	possibly damaging	Het
Fbxo15	T	A	18: 84,964,153	H288Q	probably damaging	Het
Gabrg1	T	A	5: 70,815,980	N77I	probably damaging	Het
Ganab	A	G	19: 8,912,852	Y715C	possibly damaging	Het
Hist3h2ba	T	C	11: 58,949,276	S113P	possibly damaging	Het
Iqgap2	T	C	13: 95,628,119	D1539G	probably damaging	Het
Kcp	T	C	6: 29,496,517	N633S	probably benign	Het
Krt6a	C	A	15: 101,690,543	S529I	unknown	Het
Leo1	A	G	9: 75,445,562	H129R	probably benign	Het
Lmf1	G	A	17: 25,579,349	V55M	possibly damaging	Het
Mcm9	A	G	10: 53,537,569	S472P	probably benign	Het
Med27	T	A	2: 29,377,938	V33D		Het
Mup15	C	T	4: 61,438,289	E80K	probably benign	Het
Myo18a	G	A	11: 77,859,420	R199H		Het
Nebl	T	A	2: 17,390,916	R558*	probably null	Het
Olfr1121	A	G	2: 87,372,269	T246A	probably damaging	Het
Olfr1252	A	T	2: 89,721,259	I284K	probably damaging	Het
Olfr1329	A	T	4: 118,916,986	H160Q	probably benign	Het
Olfr506	T	C	7: 108,612,991	I228T	probably damaging	Het
Olfr740	G	T	14: 50,453,885	V278L	probably benign	Het
Olfr815	T	C	10: 129,902,353	D119G	probably damaging	Het
Olfr890	A	T	9: 38,143,440	M97L	probably benign	Het
Pde11a	A	T	2: 76,215,353	F376I	possibly damaging	Het
Prima1	A	T	12: 103,235,661	C52S	probably damaging	Het
Pxn	G	A	5: 115,548,547	R366H	not run	Het
Sgce	T	C	6: 4,691,564	Y337C	probably damaging	Het
Slc25a10	T	A	11: 120,495,460	M130K	probably benign	Het
Slc29a2	A	T	19: 5,024,262	N5I	probably benign	Het
Slc35a1	A	T	4: 34,673,875	H150Q		Het
Slc5a4a	T	A	10: 76,147,550	V7D	unknown	Het
Stk17b	T	A	1: 53,766,000	D134V	probably damaging	Het
Thbs3	T	A	3: 89,216,707	S36T	probably benign	Het
Thsd4	A	G	9: 60,428,174	S152P	probably benign	Het
Tmem67	G	T	4: 12,063,698	H422N	probably benign	Het
Tram1	C	A	1: 13,589,644	V27F	probably damaging	Het
Trim14	A	G	4: 46,507,238	V326A	possibly damaging	Het

Other mutations in Col5a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00834:Col5a3	APN	9	20786389	nonsense	probably null
IGL01548:Col5a3	APN	9	20803000	splice site	probably benign
IGL02164:Col5a3	APN	9	20792643	critical splice donor site	probably null
IGL02297:Col5a3	APN	9	20772154	missense	unknown
IGL02333:Col5a3	APN	9	20799306	missense	unknown
IGL02349:Col5a3	APN	9	20772361	missense	unknown
IGL02390:Col5a3	APN	9	20776996	missense	unknown
IGL02685:Col5a3	APN	9	20772205	missense	unknown
IGL02941:Col5a3	APN	9	20804666	missense	unknown
IGL03001:Col5a3	APN	9	20807744	missense	unknown
IGL03061:Col5a3	APN	9	20797572	critical splice donor site	probably null
IGL03102:Col5a3	APN	9	20804635	critical splice donor site	probably null
IGL03308:Col5a3	APN	9	20808379	missense	unknown
IGL03372:Col5a3	APN	9	20775328	missense	unknown
Guppy	UTSW	9	20779033	missense	probably damaging	1.00
minifish	UTSW	9	20785586	missense	probably damaging	0.99
R0002:Col5a3	UTSW	9	20809856	critical splice acceptor site	probably null
R0012:Col5a3	UTSW	9	20777108	splice site	probably benign
R0316:Col5a3	UTSW	9	20775325	missense	unknown
R0357:Col5a3	UTSW	9	20807768	splice site	probably benign
R0360:Col5a3	UTSW	9	20772466	missense	unknown
R0483:Col5a3	UTSW	9	20782481	splice site	probably null
R0485:Col5a3	UTSW	9	20782708	missense	probably damaging	0.99
R0627:Col5a3	UTSW	9	20775485	missense	unknown
R1035:Col5a3	UTSW	9	20793499	splice site	probably benign
R1051:Col5a3	UTSW	9	20775235	missense	unknown
R1295:Col5a3	UTSW	9	20808418	missense	unknown
R1438:Col5a3	UTSW	9	20779957	missense	probably damaging	0.99
R1622:Col5a3	UTSW	9	20772220	missense	unknown
R1668:Col5a3	UTSW	9	20771096	missense	unknown
R1680:Col5a3	UTSW	9	20784668	critical splice donor site	probably null
R2112:Col5a3	UTSW	9	20809777	missense	unknown
R2149:Col5a3	UTSW	9	20771270	missense	unknown
R2159:Col5a3	UTSW	9	20771310	missense	unknown
R2939:Col5a3	UTSW	9	20795658	missense	unknown
R3236:Col5a3	UTSW	9	20807653	missense	unknown
R3845:Col5a3	UTSW	9	20808377	missense	unknown
R4598:Col5a3	UTSW	9	20774559	critical splice donor site	probably null
R4599:Col5a3	UTSW	9	20774559	critical splice donor site	probably null
R4611:Col5a3	UTSW	9	20814896	unclassified	probably benign
R4713:Col5a3	UTSW	9	20793574	missense	unknown
R4723:Col5a3	UTSW	9	20809591	missense	unknown
R5209:Col5a3	UTSW	9	20778643	intron	probably benign
R5336:Col5a3	UTSW	9	20799301	missense	unknown
R5378:Col5a3	UTSW	9	20797576	missense	unknown
R5614:Col5a3	UTSW	9	20783476	splice site	probably benign
R5775:Col5a3	UTSW	9	20801072	missense	unknown
R5895:Col5a3	UTSW	9	20772442	missense	unknown
R6048:Col5a3	UTSW	9	20807619	missense	unknown
R6265:Col5a3	UTSW	9	20793764	missense	unknown
R6372:Col5a3	UTSW	9	20785586	missense	probably damaging	0.99
R6520:Col5a3	UTSW	9	20774052	missense	unknown
R6558:Col5a3	UTSW	9	20779033	missense	probably damaging	1.00
R6608:Col5a3	UTSW	9	20774019	missense	unknown
R6679:Col5a3	UTSW	9	20779033	missense	probably damaging	1.00
R6680:Col5a3	UTSW	9	20779033	missense	probably damaging	1.00
R6696:Col5a3	UTSW	9	20779033	missense	probably damaging	1.00
R6698:Col5a3	UTSW	9	20779033	missense	probably damaging	1.00
R6700:Col5a3	UTSW	9	20779033	missense	probably damaging	1.00
R6708:Col5a3	UTSW	9	20775035	missense	unknown
R6712:Col5a3	UTSW	9	20779033	missense	probably damaging	1.00
R6714:Col5a3	UTSW	9	20779033	missense	probably damaging	1.00
R6828:Col5a3	UTSW	9	20798452	missense	unknown
R7343:Col5a3	UTSW	9	20793946	critical splice donor site	probably null
R7431:Col5a3	UTSW	9	20770835	makesense	probably null
R7500:Col5a3	UTSW	9	20800289	missense	unknown
R7592:Col5a3	UTSW	9	20797393	missense	unknown
R7957:Col5a3	UTSW	9	20774051	missense	unknown
R8510:Col5a3	UTSW	9	20793732	missense	unknown
R8979:Col5a3	UTSW	9	20775301	missense	unknown
R9050:Col5a3	UTSW	9	20786395	missense	probably damaging	1.00
R9052:Col5a3	UTSW	9	20799437	missense	unknown
R9072:Col5a3	UTSW	9	20771157	missense	unknown
R9341:Col5a3	UTSW	9	20793613	missense	unknown
R9343:Col5a3	UTSW	9	20793613	missense	unknown
R9529:Col5a3	UTSW	9	20774012	critical splice donor site	probably null
R9562:Col5a3	UTSW	9	20803133	missense	unknown
R9781:Col5a3	UTSW	9	20809976	missense	unknown
Z1177:Col5a3	UTSW	9	20775334	missense	unknown

Predicted Primers

PCR Primer
(F):5'- ACCATCAAGATAGGGCCAATG -3'
(R):5'- ATTGGGCCTGATGGTCTTCC -3'

Sequencing Primer
(F):5'- CCATCTGTGTGAAGGGCCAATAC -3'
(R):5'- TGGTCTTCCAGGGATCCC -3'

Posted On

2019-11-12