Incidental Mutation 'R7671:Thsd4'
ID592164
Institutional Source Beutler Lab
Gene Symbol Thsd4
Ensembl Gene ENSMUSG00000032289
Gene Namethrombospondin, type I, domain containing 4
SynonymsADAMTSL6, B230114P05Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R7671 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location59966931-60522046 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 60428174 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 152 (S152P)
Ref Sequence ENSEMBL: ENSMUSP00000096257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098660] [ENSMUST00000140824] [ENSMUST00000171654]
Predicted Effect probably benign
Transcript: ENSMUST00000098660
AA Change: S152P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000096257
Gene: ENSMUSG00000032289
AA Change: S152P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
TSP1 57 100 7.9e-2 SMART
low complexity region 160 175 N/A INTRINSIC
low complexity region 187 202 N/A INTRINSIC
Pfam:ADAM_spacer1 412 528 1.5e-39 PFAM
low complexity region 549 565 N/A INTRINSIC
TSP1 621 677 1.51e-1 SMART
TSP1 679 737 8.11e-5 SMART
TSP1 739 794 7.92e-8 SMART
TSP1 796 851 1.6e-3 SMART
TSP1 855 913 4.82e-2 SMART
TSP1 916 968 1.03e-6 SMART
Pfam:PLAC 974 1006 4.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140824
SMART Domains Protein: ENSMUSP00000123323
Gene: ENSMUSG00000032289

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
TSP1 57 100 7.9e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171654
AA Change: S152P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131418
Gene: ENSMUSG00000032289
AA Change: S152P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
TSP1 57 100 7.9e-2 SMART
low complexity region 160 175 N/A INTRINSIC
low complexity region 187 202 N/A INTRINSIC
Pfam:ADAM_spacer1 412 528 5.4e-40 PFAM
low complexity region 549 565 N/A INTRINSIC
TSP1 621 677 1.51e-1 SMART
TSP1 679 737 8.11e-5 SMART
TSP1 739 794 7.92e-8 SMART
TSP1 796 851 1.6e-3 SMART
TSP1 855 913 4.82e-2 SMART
TSP1 916 968 1.03e-6 SMART
Pfam:PLAC 975 1005 1.3e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T A 18: 38,259,925 I394N probably damaging Het
4930435E12Rik C T 16: 38,828,091 D219N possibly damaging Het
4932438A13Rik T C 3: 36,943,231 F1146L probably damaging Het
4933406M09Rik T C 1: 134,390,062 C191R probably benign Het
Akap13 C A 7: 75,569,900 T17K probably damaging Het
Ankrd29 T A 18: 12,260,986 K257I probably damaging Het
Bicc1 A G 10: 70,957,167 L219P probably benign Het
Boc C T 16: 44,491,849 V617M Het
Ccl8 A G 11: 82,115,207 probably benign Het
Col18a1 A G 10: 77,085,383 L261P unknown Het
Col5a3 T A 9: 20,775,086 probably null Het
Cryba4 A C 5: 112,248,173 probably null Het
Csf2rb A G 15: 78,338,930 Y114C probably damaging Het
Ctif T C 18: 75,472,016 D484G probably damaging Het
Ctnnal1 A G 4: 56,837,848 F261L probably damaging Het
Defb22 A T 2: 152,486,030 N78K unknown Het
Efr3a G A 15: 65,837,434 probably null Het
Elp4 G T 2: 105,904,481 A3E probably damaging Het
Emilin2 A G 17: 71,273,910 V607A probably benign Het
Epsti1 A G 14: 77,904,490 Y2C probably damaging Het
Fam81b A C 13: 76,271,293 L46R probably damaging Het
Fam81b G T 13: 76,271,294 L46I possibly damaging Het
Fbxo15 T A 18: 84,964,153 H288Q probably damaging Het
Gabrg1 T A 5: 70,815,980 N77I probably damaging Het
Ganab A G 19: 8,912,852 Y715C possibly damaging Het
Hist3h2ba T C 11: 58,949,276 S113P possibly damaging Het
Iqgap2 T C 13: 95,628,119 D1539G probably damaging Het
Kcp T C 6: 29,496,517 N633S probably benign Het
Krt6a C A 15: 101,690,543 S529I unknown Het
Leo1 A G 9: 75,445,562 H129R probably benign Het
Lmf1 G A 17: 25,579,349 V55M possibly damaging Het
Mcm9 A G 10: 53,537,569 S472P probably benign Het
Med27 T A 2: 29,377,938 V33D Het
Mup15 C T 4: 61,438,289 E80K probably benign Het
Myo18a G A 11: 77,859,420 R199H Het
Nebl T A 2: 17,390,916 R558* probably null Het
Olfr1121 A G 2: 87,372,269 T246A probably damaging Het
Olfr1252 A T 2: 89,721,259 I284K probably damaging Het
Olfr1329 A T 4: 118,916,986 H160Q probably benign Het
Olfr506 T C 7: 108,612,991 I228T probably damaging Het
Olfr740 G T 14: 50,453,885 V278L probably benign Het
Olfr815 T C 10: 129,902,353 D119G probably damaging Het
Olfr890 A T 9: 38,143,440 M97L probably benign Het
Pde11a A T 2: 76,215,353 F376I possibly damaging Het
Prima1 A T 12: 103,235,661 C52S probably damaging Het
Pxn G A 5: 115,548,547 R366H not run Het
Sgce T C 6: 4,691,564 Y337C probably damaging Het
Slc25a10 T A 11: 120,495,460 M130K probably benign Het
Slc29a2 A T 19: 5,024,262 N5I probably benign Het
Slc35a1 A T 4: 34,673,875 H150Q Het
Slc5a4a T A 10: 76,147,550 V7D unknown Het
Stk17b T A 1: 53,766,000 D134V probably damaging Het
Thbs3 T A 3: 89,216,707 S36T probably benign Het
Tmem67 G T 4: 12,063,698 H422N probably benign Het
Tram1 C A 1: 13,589,644 V27F probably damaging Het
Trim14 A G 4: 46,507,238 V326A possibly damaging Het
Other mutations in Thsd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02206:Thsd4 APN 9 60394115 missense probably benign 0.22
IGL02418:Thsd4 APN 9 60428315 missense probably damaging 0.99
IGL02491:Thsd4 APN 9 60000018 missense probably damaging 0.99
IGL02754:Thsd4 APN 9 59989097 splice site probably benign
IGL02874:Thsd4 APN 9 60252730 missense probably damaging 1.00
IGL02978:Thsd4 APN 9 60056846 splice site probably null
IGL03139:Thsd4 APN 9 59997173 missense probably benign 0.01
R0266:Thsd4 UTSW 9 59997134 missense probably benign 0.07
R0482:Thsd4 UTSW 9 60002978 missense probably damaging 1.00
R1188:Thsd4 UTSW 9 60394406 missense probably benign 0.12
R1447:Thsd4 UTSW 9 59997213 missense probably benign
R1572:Thsd4 UTSW 9 60394553 splice site probably benign
R1812:Thsd4 UTSW 9 60056937 missense probably damaging 1.00
R2349:Thsd4 UTSW 9 59972515 missense probably benign 0.05
R3236:Thsd4 UTSW 9 60394387 missense probably benign
R4088:Thsd4 UTSW 9 59997222 missense probably benign 0.02
R4884:Thsd4 UTSW 9 59988037 missense probably benign 0.43
R4886:Thsd4 UTSW 9 59989030 missense probably benign 0.00
R5066:Thsd4 UTSW 9 59976332 missense probably damaging 1.00
R5223:Thsd4 UTSW 9 60057042 missense probably damaging 1.00
R5441:Thsd4 UTSW 9 59979783 missense probably damaging 1.00
R5457:Thsd4 UTSW 9 59979777 missense probably damaging 1.00
R5574:Thsd4 UTSW 9 59972400 missense probably damaging 1.00
R5581:Thsd4 UTSW 9 59972458 missense possibly damaging 0.90
R5903:Thsd4 UTSW 9 60394106 missense possibly damaging 0.47
R6220:Thsd4 UTSW 9 59982747 missense probably damaging 1.00
R6728:Thsd4 UTSW 9 59997197 missense probably benign
R7102:Thsd4 UTSW 9 59976304 missense probably damaging 1.00
R7316:Thsd4 UTSW 9 59987359 missense probably benign 0.00
R7403:Thsd4 UTSW 9 60056887 missense probably damaging 0.99
R7638:Thsd4 UTSW 9 60394472 missense probably damaging 1.00
R7856:Thsd4 UTSW 9 60002861 missense probably damaging 1.00
Z1177:Thsd4 UTSW 9 59988094 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAATGGCGTCTCAGAATTCTCTTCAC -3'
(R):5'- TGGTGTGATGGAGCAGACAC -3'

Sequencing Primer
(F):5'- CCTTGGTTCTGTAAAGGCAAC -3'
(R):5'- TCCTACCGTGCTCGAGGAG -3'
Posted On2019-11-12