Incidental Mutation 'R7671:Slc5a4a'
ID 592168
Institutional Source Beutler Lab
Gene Symbol Slc5a4a
Ensembl Gene ENSMUSG00000020229
Gene Name solute carrier family 5, member 4a
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock # R7671 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 76147451-76189265 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 76147550 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 7 (V7D)
Ref Sequence ENSEMBL: ENSMUSP00000020450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020450]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000020450
AA Change: V7D
SMART Domains Protein: ENSMUSP00000020450
Gene: ENSMUSG00000020229
AA Change: V7D

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
Pfam:SSF 58 492 4e-161 PFAM
transmembrane domain 526 548 N/A INTRINSIC
transmembrane domain 636 655 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T A 18: 38,259,925 I394N probably damaging Het
4930435E12Rik C T 16: 38,828,091 D219N possibly damaging Het
4932438A13Rik T C 3: 36,943,231 F1146L probably damaging Het
4933406M09Rik T C 1: 134,390,062 C191R probably benign Het
Akap13 C A 7: 75,569,900 T17K probably damaging Het
Ankrd29 T A 18: 12,260,986 K257I probably damaging Het
Bicc1 A G 10: 70,957,167 L219P probably benign Het
Boc C T 16: 44,491,849 V617M Het
Ccl8 A G 11: 82,115,207 probably benign Het
Col18a1 A G 10: 77,085,383 L261P unknown Het
Col5a3 T A 9: 20,775,086 probably null Het
Cryba4 A C 5: 112,248,173 probably null Het
Csf2rb A G 15: 78,338,930 Y114C probably damaging Het
Ctif T C 18: 75,472,016 D484G probably damaging Het
Ctnnal1 A G 4: 56,837,848 F261L probably damaging Het
Defb22 A T 2: 152,486,030 N78K unknown Het
Efr3a G A 15: 65,837,434 probably null Het
Elp4 G T 2: 105,904,481 A3E probably damaging Het
Emilin2 A G 17: 71,273,910 V607A probably benign Het
Epsti1 A G 14: 77,904,490 Y2C probably damaging Het
Fam81b A C 13: 76,271,293 L46R probably damaging Het
Fam81b G T 13: 76,271,294 L46I possibly damaging Het
Fbxo15 T A 18: 84,964,153 H288Q probably damaging Het
Gabrg1 T A 5: 70,815,980 N77I probably damaging Het
Ganab A G 19: 8,912,852 Y715C possibly damaging Het
Hist3h2ba T C 11: 58,949,276 S113P possibly damaging Het
Iqgap2 T C 13: 95,628,119 D1539G probably damaging Het
Kcp T C 6: 29,496,517 N633S probably benign Het
Krt6a C A 15: 101,690,543 S529I unknown Het
Leo1 A G 9: 75,445,562 H129R probably benign Het
Lmf1 G A 17: 25,579,349 V55M possibly damaging Het
Mcm9 A G 10: 53,537,569 S472P probably benign Het
Med27 T A 2: 29,377,938 V33D Het
Mup15 C T 4: 61,438,289 E80K probably benign Het
Myo18a G A 11: 77,859,420 R199H Het
Nebl T A 2: 17,390,916 R558* probably null Het
Olfr1121 A G 2: 87,372,269 T246A probably damaging Het
Olfr1252 A T 2: 89,721,259 I284K probably damaging Het
Olfr1329 A T 4: 118,916,986 H160Q probably benign Het
Olfr506 T C 7: 108,612,991 I228T probably damaging Het
Olfr740 G T 14: 50,453,885 V278L probably benign Het
Olfr815 T C 10: 129,902,353 D119G probably damaging Het
Olfr890 A T 9: 38,143,440 M97L probably benign Het
Pde11a A T 2: 76,215,353 F376I possibly damaging Het
Prima1 A T 12: 103,235,661 C52S probably damaging Het
Pxn G A 5: 115,548,547 R366H not run Het
Sgce T C 6: 4,691,564 Y337C probably damaging Het
Slc25a10 T A 11: 120,495,460 M130K probably benign Het
Slc29a2 A T 19: 5,024,262 N5I probably benign Het
Slc35a1 A T 4: 34,673,875 H150Q Het
Stk17b T A 1: 53,766,000 D134V probably damaging Het
Thbs3 T A 3: 89,216,707 S36T probably benign Het
Thsd4 A G 9: 60,428,174 S152P probably benign Het
Tmem67 G T 4: 12,063,698 H422N probably benign Het
Tram1 C A 1: 13,589,644 V27F probably damaging Het
Trim14 A G 4: 46,507,238 V326A possibly damaging Het
Other mutations in Slc5a4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00670:Slc5a4a APN 10 76163733 missense probably damaging 1.00
IGL01725:Slc5a4a APN 10 76181674 missense probably benign 0.00
IGL02629:Slc5a4a APN 10 76147579 missense unknown
IGL02976:Slc5a4a APN 10 76170693 missense possibly damaging 0.67
IGL03255:Slc5a4a APN 10 76150512 missense probably damaging 1.00
IGL03258:Slc5a4a APN 10 76150552 missense possibly damaging 0.81
R0054:Slc5a4a UTSW 10 76178197 missense probably null 0.00
R0244:Slc5a4a UTSW 10 76189152 missense possibly damaging 0.46
R0398:Slc5a4a UTSW 10 76182722 missense possibly damaging 0.46
R0799:Slc5a4a UTSW 10 76176534 missense probably benign 0.00
R1160:Slc5a4a UTSW 10 76178161 missense possibly damaging 0.52
R1471:Slc5a4a UTSW 10 76186528 missense probably damaging 0.99
R1720:Slc5a4a UTSW 10 76189269 splice site probably null
R1857:Slc5a4a UTSW 10 76166735 missense probably benign 0.27
R1858:Slc5a4a UTSW 10 76166735 missense probably benign 0.27
R1859:Slc5a4a UTSW 10 76166735 missense probably benign 0.27
R1942:Slc5a4a UTSW 10 76147588 missense unknown
R2016:Slc5a4a UTSW 10 76153580 missense probably benign 0.00
R2316:Slc5a4a UTSW 10 76178081 splice site probably null
R3420:Slc5a4a UTSW 10 76176573 missense probably benign 0.00
R3421:Slc5a4a UTSW 10 76176573 missense probably benign 0.00
R3422:Slc5a4a UTSW 10 76176573 missense probably benign 0.00
R3845:Slc5a4a UTSW 10 76189149 missense probably damaging 0.99
R3874:Slc5a4a UTSW 10 76181655 missense probably benign 0.42
R4523:Slc5a4a UTSW 10 76148362 missense probably damaging 0.99
R4537:Slc5a4a UTSW 10 76178095 nonsense probably null
R4538:Slc5a4a UTSW 10 76178095 nonsense probably null
R4755:Slc5a4a UTSW 10 76186564 missense probably benign 0.00
R4868:Slc5a4a UTSW 10 76178231 missense probably damaging 0.98
R5135:Slc5a4a UTSW 10 76147594 missense unknown
R5254:Slc5a4a UTSW 10 76182738 nonsense probably null
R6083:Slc5a4a UTSW 10 76147597 missense unknown
R6331:Slc5a4a UTSW 10 76178200 missense probably damaging 0.98
R7591:Slc5a4a UTSW 10 76147667 critical splice donor site probably benign
R8785:Slc5a4a UTSW 10 76150404 critical splice acceptor site probably benign
R8929:Slc5a4a UTSW 10 76170783 missense probably benign 0.27
R8993:Slc5a4a UTSW 10 76186535 missense probably benign 0.15
R9018:Slc5a4a UTSW 10 76166712 missense possibly damaging 0.67
R9474:Slc5a4a UTSW 10 76150404 critical splice acceptor site probably benign
R9567:Slc5a4a UTSW 10 76186562 missense probably benign 0.08
Z1177:Slc5a4a UTSW 10 76166744 missense probably benign 0.01
Z1177:Slc5a4a UTSW 10 76182847 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCAATTCCACTCAGGCTGG -3'
(R):5'- ACTGTGACATGTTTTCCCTGG -3'

Sequencing Primer
(F):5'- TGGCACTAGTCACCTTGAAG -3'
(R):5'- GGTAATCTTAGTGCCCACCCAG -3'
Posted On 2019-11-12