Mutagenetix > Incidental Mutations

Incidental Mutation 'R7671:Olfr815'

592170

Institutional Source

Beutler Lab

Gene Symbol

Olfr815

Ensembl Gene

ENSMUSG00000061961

Gene Name

olfactory receptor 815

Synonyms

GA_x6K02T2PULF-11581263-11580331, MOR113-3

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.058) question?

Stock #

R7671 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

129900570-129905867 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 129902353 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 119 (D119G)

Ref Sequence

ENSEMBL: ENSMUSP00000151146 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071557] [ENSMUST00000216182]

Predicted Effect

probably damaging
Transcript: ENSMUST00000071557
AA Change: D125G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000071488
Gene: ENSMUSG00000061961
AA Change: D125G

Domain	Start	End	E-Value	Type
Pfam:7tm_4	35	313	4.2e-45	PFAM
Pfam:7tm_1	45	294	1.2e-23	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000216182
AA Change: D119G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	T	A	18: 38,259,925	I394N	probably damaging	Het
4930435E12Rik	C	T	16: 38,828,091	D219N	possibly damaging	Het
4932438A13Rik	T	C	3: 36,943,231	F1146L	probably damaging	Het
4933406M09Rik	T	C	1: 134,390,062	C191R	probably benign	Het
Akap13	C	A	7: 75,569,900	T17K	probably damaging	Het
Ankrd29	T	A	18: 12,260,986	K257I	probably damaging	Het
Bicc1	A	G	10: 70,957,167	L219P	probably benign	Het
Boc	C	T	16: 44,491,849	V617M		Het
Ccl8	A	G	11: 82,115,207		probably benign	Het
Col18a1	A	G	10: 77,085,383	L261P	unknown	Het
Col5a3	T	A	9: 20,775,086		probably null	Het
Cryba4	A	C	5: 112,248,173		probably null	Het
Csf2rb	A	G	15: 78,338,930	Y114C	probably damaging	Het
Ctif	T	C	18: 75,472,016	D484G	probably damaging	Het
Ctnnal1	A	G	4: 56,837,848	F261L	probably damaging	Het
Defb22	A	T	2: 152,486,030	N78K	unknown	Het
Efr3a	G	A	15: 65,837,434		probably null	Het
Elp4	G	T	2: 105,904,481	A3E	probably damaging	Het
Emilin2	A	G	17: 71,273,910	V607A	probably benign	Het
Epsti1	A	G	14: 77,904,490	Y2C	probably damaging	Het
Fam81b	A	C	13: 76,271,293	L46R	probably damaging	Het
Fam81b	G	T	13: 76,271,294	L46I	possibly damaging	Het
Fbxo15	T	A	18: 84,964,153	H288Q	probably damaging	Het
Gabrg1	T	A	5: 70,815,980	N77I	probably damaging	Het
Ganab	A	G	19: 8,912,852	Y715C	possibly damaging	Het
Hist3h2ba	T	C	11: 58,949,276	S113P	possibly damaging	Het
Iqgap2	T	C	13: 95,628,119	D1539G	probably damaging	Het
Kcp	T	C	6: 29,496,517	N633S	probably benign	Het
Krt6a	C	A	15: 101,690,543	S529I	unknown	Het
Leo1	A	G	9: 75,445,562	H129R	probably benign	Het
Lmf1	G	A	17: 25,579,349	V55M	possibly damaging	Het
Mcm9	A	G	10: 53,537,569	S472P	probably benign	Het
Med27	T	A	2: 29,377,938	V33D		Het
Mup15	C	T	4: 61,438,289	E80K	probably benign	Het
Myo18a	G	A	11: 77,859,420	R199H		Het
Nebl	T	A	2: 17,390,916	R558*	probably null	Het
Olfr1121	A	G	2: 87,372,269	T246A	probably damaging	Het
Olfr1252	A	T	2: 89,721,259	I284K	probably damaging	Het
Olfr1329	A	T	4: 118,916,986	H160Q	probably benign	Het
Olfr506	T	C	7: 108,612,991	I228T	probably damaging	Het
Olfr740	G	T	14: 50,453,885	V278L	probably benign	Het
Olfr890	A	T	9: 38,143,440	M97L	probably benign	Het
Pde11a	A	T	2: 76,215,353	F376I	possibly damaging	Het
Prima1	A	T	12: 103,235,661	C52S	probably damaging	Het
Pxn	G	A	5: 115,548,547	R366H	not run	Het
Sgce	T	C	6: 4,691,564	Y337C	probably damaging	Het
Slc25a10	T	A	11: 120,495,460	M130K	probably benign	Het
Slc29a2	A	T	19: 5,024,262	N5I	probably benign	Het
Slc35a1	A	T	4: 34,673,875	H150Q		Het
Slc5a4a	T	A	10: 76,147,550	V7D	unknown	Het
Stk17b	T	A	1: 53,766,000	D134V	probably damaging	Het
Thbs3	T	A	3: 89,216,707	S36T	probably benign	Het
Thsd4	A	G	9: 60,428,174	S152P	probably benign	Het
Tmem67	G	T	4: 12,063,698	H422N	probably benign	Het
Tram1	C	A	1: 13,589,644	V27F	probably damaging	Het
Trim14	A	G	4: 46,507,238	V326A	possibly damaging	Het

Other mutations in Olfr815

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Olfr815	APN	10	129902659	missense	possibly damaging	0.94
IGL01901:Olfr815	APN	10	129901853	missense	probably benign	0.19
IGL02687:Olfr815	APN	10	129902102	missense	probably benign	0.00
IGL02932:Olfr815	APN	10	129902418	nonsense	probably null
IGL03327:Olfr815	APN	10	129902582	missense	possibly damaging	0.87
R0894:Olfr815	UTSW	10	129901882	missense	probably damaging	0.97
R1299:Olfr815	UTSW	10	129902077	missense	probably benign	0.32
R1544:Olfr815	UTSW	10	129902424	nonsense	probably null
R1939:Olfr815	UTSW	10	129902101	missense	probably damaging	0.96
R2379:Olfr815	UTSW	10	129901912	missense	probably damaging	0.99
R2435:Olfr815	UTSW	10	129902304	missense	possibly damaging	0.52
R2566:Olfr815	UTSW	10	129902095	missense	probably damaging	1.00
R2892:Olfr815	UTSW	10	129901940	missense	possibly damaging	0.60
R2905:Olfr815	UTSW	10	129902400	missense	possibly damaging	0.93
R4552:Olfr815	UTSW	10	129902123	missense	probably benign	0.00
R6566:Olfr815	UTSW	10	129902078	missense	probably benign	0.00
R6988:Olfr815	UTSW	10	129902409	missense	probably damaging	0.98
Z1088:Olfr815	UTSW	10	129902683	missense	possibly damaging	0.49

Predicted Primers

PCR Primer
(F):5'- TGTTTGAGCAAGAGAGCTGTAG -3'
(R):5'- ACTTGCTGAGTATGCTCGGG -3'

Sequencing Primer
(F):5'- AACATCACAAAGGAAATGGTCAATG -3'
(R):5'- CGGGAATTTAGCTATCATTGCC -3'

Posted On

2019-11-12