Incidental Mutation 'R7671:Hist3h2ba'
ID592171
Institutional Source Beutler Lab
Gene Symbol Hist3h2ba
Ensembl Gene ENSMUSG00000056895
Gene Namehistone cluster 3, H2ba
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock #R7671 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location58948920-58949533 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58949276 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 113 (S113P)
Ref Sequence ENSEMBL: ENSMUSP00000076397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078267]
PDB Structure
Crystal structure of the nucleosome core particle containing the histone domain of macroH2A [X-RAY DIFFRACTION]
2.9 Angstrom X-ray structure of hybrid macroH2A nucleosomes [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078267
AA Change: S113P

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000076397
Gene: ENSMUSG00000056895
AA Change: S113P

DomainStartEndE-ValueType
H2B 28 124 4.33e-72 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2B family. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T A 18: 38,259,925 I394N probably damaging Het
4930435E12Rik C T 16: 38,828,091 D219N possibly damaging Het
4932438A13Rik T C 3: 36,943,231 F1146L probably damaging Het
4933406M09Rik T C 1: 134,390,062 C191R probably benign Het
Akap13 C A 7: 75,569,900 T17K probably damaging Het
Ankrd29 T A 18: 12,260,986 K257I probably damaging Het
Bicc1 A G 10: 70,957,167 L219P probably benign Het
Boc C T 16: 44,491,849 V617M Het
Ccl8 A G 11: 82,115,207 probably benign Het
Col18a1 A G 10: 77,085,383 L261P unknown Het
Col5a3 T A 9: 20,775,086 probably null Het
Cryba4 A C 5: 112,248,173 probably null Het
Csf2rb A G 15: 78,338,930 Y114C probably damaging Het
Ctif T C 18: 75,472,016 D484G probably damaging Het
Ctnnal1 A G 4: 56,837,848 F261L probably damaging Het
Defb22 A T 2: 152,486,030 N78K unknown Het
Efr3a G A 15: 65,837,434 probably null Het
Elp4 G T 2: 105,904,481 A3E probably damaging Het
Emilin2 A G 17: 71,273,910 V607A probably benign Het
Epsti1 A G 14: 77,904,490 Y2C probably damaging Het
Fam81b A C 13: 76,271,293 L46R probably damaging Het
Fam81b G T 13: 76,271,294 L46I possibly damaging Het
Fbxo15 T A 18: 84,964,153 H288Q probably damaging Het
Gabrg1 T A 5: 70,815,980 N77I probably damaging Het
Ganab A G 19: 8,912,852 Y715C possibly damaging Het
Iqgap2 T C 13: 95,628,119 D1539G probably damaging Het
Kcp T C 6: 29,496,517 N633S probably benign Het
Krt6a C A 15: 101,690,543 S529I unknown Het
Leo1 A G 9: 75,445,562 H129R probably benign Het
Lmf1 G A 17: 25,579,349 V55M possibly damaging Het
Mcm9 A G 10: 53,537,569 S472P probably benign Het
Med27 T A 2: 29,377,938 V33D Het
Mup15 C T 4: 61,438,289 E80K probably benign Het
Myo18a G A 11: 77,859,420 R199H Het
Nebl T A 2: 17,390,916 R558* probably null Het
Olfr1121 A G 2: 87,372,269 T246A probably damaging Het
Olfr1252 A T 2: 89,721,259 I284K probably damaging Het
Olfr1329 A T 4: 118,916,986 H160Q probably benign Het
Olfr506 T C 7: 108,612,991 I228T probably damaging Het
Olfr740 G T 14: 50,453,885 V278L probably benign Het
Olfr815 T C 10: 129,902,353 D119G probably damaging Het
Olfr890 A T 9: 38,143,440 M97L probably benign Het
Pde11a A T 2: 76,215,353 F376I possibly damaging Het
Prima1 A T 12: 103,235,661 C52S probably damaging Het
Pxn G A 5: 115,548,547 R366H not run Het
Sgce T C 6: 4,691,564 Y337C probably damaging Het
Slc25a10 T A 11: 120,495,460 M130K probably benign Het
Slc29a2 A T 19: 5,024,262 N5I probably benign Het
Slc35a1 A T 4: 34,673,875 H150Q Het
Slc5a4a T A 10: 76,147,550 V7D unknown Het
Stk17b T A 1: 53,766,000 D134V probably damaging Het
Thbs3 T A 3: 89,216,707 S36T probably benign Het
Thsd4 A G 9: 60,428,174 S152P probably benign Het
Tmem67 G T 4: 12,063,698 H422N probably benign Het
Tram1 C A 1: 13,589,644 V27F probably damaging Het
Trim14 A G 4: 46,507,238 V326A possibly damaging Het
Other mutations in Hist3h2ba
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02832:Hist3h2ba APN 11 58949043 missense probably benign 0.06
R1848:Hist3h2ba UTSW 11 58949102 missense possibly damaging 0.94
R3083:Hist3h2ba UTSW 11 58948976 missense probably benign 0.01
R4193:Hist3h2ba UTSW 11 58949241 missense probably damaging 1.00
R4657:Hist3h2ba UTSW 11 58948971 missense probably benign 0.09
R5550:Hist3h2ba UTSW 11 58949320 makesense probably null
R5777:Hist3h2ba UTSW 11 58949009 missense probably benign 0.00
X0019:Hist3h2ba UTSW 11 58949055 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TACGTGTACAAGGTGCTGAAG -3'
(R):5'- AGGATCCCAAGGTCCAGTAC -3'

Sequencing Primer
(F):5'- TGAAGCAGGTGCATCCG -3'
(R):5'- GGATCCCAAGGTCCAGTACAACAC -3'
Posted On2019-11-12