Incidental Mutation 'R7671:Myo18a'
ID592172
Institutional Source Beutler Lab
Gene Symbol Myo18a
Ensembl Gene ENSMUSG00000000631
Gene Namemyosin XVIIIA
SynonymsMyoPDZ
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7671 (G1)
Quality Score137.008
Status Not validated
Chromosome11
Chromosomal Location77763246-77865980 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 77859420 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 199 (R199H)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000645] [ENSMUST00000092884] [ENSMUST00000092887] [ENSMUST00000100794] [ENSMUST00000102488] [ENSMUST00000108375] [ENSMUST00000108376] [ENSMUST00000130305] [ENSMUST00000130627] [ENSMUST00000164334] [ENSMUST00000167856] [ENSMUST00000168348] [ENSMUST00000169105] [ENSMUST00000172303]
Predicted Effect probably benign
Transcript: ENSMUST00000000645
SMART Domains Protein: ENSMUSP00000000645
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 399 1183 1.53e-45 SMART
IQ 1184 1206 1.11e-3 SMART
Pfam:Myosin_tail_1 1219 1867 1.7e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092884
SMART Domains Protein: ENSMUSP00000090560
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
MYSc 68 851 4.16e-47 SMART
IQ 852 874 1.11e-3 SMART
Pfam:Myosin_tail_1 888 1534 2e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092887
SMART Domains Protein: ENSMUSP00000090563
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 399 1182 4.16e-47 SMART
IQ 1183 1205 1.11e-3 SMART
Pfam:Myosin_tail_1 1218 1866 3e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100794
SMART Domains Protein: ENSMUSP00000098358
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
MYSc 68 847 1.45e-46 SMART
IQ 848 870 1.11e-3 SMART
Pfam:Myosin_tail_1 884 1530 4.9e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102488
SMART Domains Protein: ENSMUSP00000099546
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 399 1182 4.16e-47 SMART
IQ 1183 1205 1.11e-3 SMART
Pfam:Myosin_tail_1 1218 1866 3e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108375
SMART Domains Protein: ENSMUSP00000104012
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 399 1182 4.16e-47 SMART
IQ 1183 1205 1.11e-3 SMART
Pfam:Myosin_tail_1 1218 1838 6.8e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108376
SMART Domains Protein: ENSMUSP00000104013
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 399 1182 4.16e-47 SMART
IQ 1183 1205 1.11e-3 SMART
Blast:MYSc 1258 1387 1e-14 BLAST
low complexity region 1396 1407 N/A INTRINSIC
low complexity region 1743 1762 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130305
SMART Domains Protein: ENSMUSP00000119574
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
MYSc 80 863 4.16e-47 SMART
IQ 864 886 1.11e-3 SMART
Pfam:Myosin_tail_1 902 1547 2.6e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130627
SMART Domains Protein: ENSMUSP00000119839
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 411 1194 4.16e-47 SMART
IQ 1195 1217 1.11e-3 SMART
Pfam:Myosin_tail_1 1230 1850 6.9e-36 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000117044
Gene: ENSMUSG00000000631
AA Change: R199H

DomainStartEndE-ValueType
low complexity region 198 231 N/A INTRINSIC
low complexity region 289 303 N/A INTRINSIC
low complexity region 361 459 N/A INTRINSIC
low complexity region 474 486 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164334
SMART Domains Protein: ENSMUSP00000131771
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
MYSc 68 851 4.16e-47 SMART
IQ 852 874 1.11e-3 SMART
Pfam:Myosin_tail_1 888 1505 4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167856
SMART Domains Protein: ENSMUSP00000128487
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
MYSc 16 789 1.3e-32 SMART
IQ 790 812 1.11e-3 SMART
Blast:MYSc 865 994 1e-14 BLAST
low complexity region 1003 1014 N/A INTRINSIC
low complexity region 1387 1406 N/A INTRINSIC
internal_repeat_1 1569 1627 2.13e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000168348
SMART Domains Protein: ENSMUSP00000130696
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 447 1230 4.16e-47 SMART
IQ 1231 1253 1.11e-3 SMART
Blast:MYSc 1306 1435 1e-14 BLAST
low complexity region 1444 1455 N/A INTRINSIC
low complexity region 1828 1847 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169105
SMART Domains Protein: ENSMUSP00000132149
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 411 1194 4.16e-47 SMART
IQ 1195 1217 1.11e-3 SMART
Pfam:Myosin_tail_1 1230 1878 7.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172303
SMART Domains Protein: ENSMUSP00000129098
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
MYSc 80 863 4.16e-47 SMART
IQ 864 886 1.11e-3 SMART
Pfam:Myosin_tail_1 902 1547 2.6e-34 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene can bind GOLPH3, linking the Golgi to the cytoskeleton and influencing Golgi membrane trafficking. The encoded protein is also part of a complex that assembles lamellar actomyosin bundles and may be required for cell migration. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T A 18: 38,259,925 I394N probably damaging Het
4930435E12Rik C T 16: 38,828,091 D219N possibly damaging Het
4932438A13Rik T C 3: 36,943,231 F1146L probably damaging Het
4933406M09Rik T C 1: 134,390,062 C191R probably benign Het
Akap13 C A 7: 75,569,900 T17K probably damaging Het
Ankrd29 T A 18: 12,260,986 K257I probably damaging Het
Bicc1 A G 10: 70,957,167 L219P probably benign Het
Boc C T 16: 44,491,849 V617M Het
Ccl8 A G 11: 82,115,207 probably benign Het
Col18a1 A G 10: 77,085,383 L261P unknown Het
Col5a3 T A 9: 20,775,086 probably null Het
Cryba4 A C 5: 112,248,173 probably null Het
Csf2rb A G 15: 78,338,930 Y114C probably damaging Het
Ctif T C 18: 75,472,016 D484G probably damaging Het
Ctnnal1 A G 4: 56,837,848 F261L probably damaging Het
Defb22 A T 2: 152,486,030 N78K unknown Het
Efr3a G A 15: 65,837,434 probably null Het
Elp4 G T 2: 105,904,481 A3E probably damaging Het
Emilin2 A G 17: 71,273,910 V607A probably benign Het
Epsti1 A G 14: 77,904,490 Y2C probably damaging Het
Fam81b A C 13: 76,271,293 L46R probably damaging Het
Fam81b G T 13: 76,271,294 L46I possibly damaging Het
Fbxo15 T A 18: 84,964,153 H288Q probably damaging Het
Gabrg1 T A 5: 70,815,980 N77I probably damaging Het
Ganab A G 19: 8,912,852 Y715C possibly damaging Het
Hist3h2ba T C 11: 58,949,276 S113P possibly damaging Het
Iqgap2 T C 13: 95,628,119 D1539G probably damaging Het
Kcp T C 6: 29,496,517 N633S probably benign Het
Krt6a C A 15: 101,690,543 S529I unknown Het
Leo1 A G 9: 75,445,562 H129R probably benign Het
Lmf1 G A 17: 25,579,349 V55M possibly damaging Het
Mcm9 A G 10: 53,537,569 S472P probably benign Het
Med27 T A 2: 29,377,938 V33D Het
Mup15 C T 4: 61,438,289 E80K probably benign Het
Nebl T A 2: 17,390,916 R558* probably null Het
Olfr1121 A G 2: 87,372,269 T246A probably damaging Het
Olfr1252 A T 2: 89,721,259 I284K probably damaging Het
Olfr1329 A T 4: 118,916,986 H160Q probably benign Het
Olfr506 T C 7: 108,612,991 I228T probably damaging Het
Olfr740 G T 14: 50,453,885 V278L probably benign Het
Olfr815 T C 10: 129,902,353 D119G probably damaging Het
Olfr890 A T 9: 38,143,440 M97L probably benign Het
Pde11a A T 2: 76,215,353 F376I possibly damaging Het
Prima1 A T 12: 103,235,661 C52S probably damaging Het
Pxn G A 5: 115,548,547 R366H not run Het
Sgce T C 6: 4,691,564 Y337C probably damaging Het
Slc25a10 T A 11: 120,495,460 M130K probably benign Het
Slc29a2 A T 19: 5,024,262 N5I probably benign Het
Slc35a1 A T 4: 34,673,875 H150Q Het
Slc5a4a T A 10: 76,147,550 V7D unknown Het
Stk17b T A 1: 53,766,000 D134V probably damaging Het
Thbs3 T A 3: 89,216,707 S36T probably benign Het
Thsd4 A G 9: 60,428,174 S152P probably benign Het
Tmem67 G T 4: 12,063,698 H422N probably benign Het
Tram1 C A 1: 13,589,644 V27F probably damaging Het
Trim14 A G 4: 46,507,238 V326A possibly damaging Het
Other mutations in Myo18a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Myo18a APN 11 77847938 missense probably damaging 1.00
IGL00753:Myo18a APN 11 77825151 missense probably damaging 1.00
IGL01137:Myo18a APN 11 77827829 missense probably damaging 1.00
IGL01536:Myo18a APN 11 77820851 missense probably damaging 1.00
IGL01642:Myo18a APN 11 77864732 missense probably benign 0.07
IGL01728:Myo18a APN 11 77777856 missense probably damaging 0.99
IGL01780:Myo18a APN 11 77850247 missense probably benign 0.02
IGL02286:Myo18a APN 11 77777985 nonsense probably null
IGL02350:Myo18a APN 11 77850247 missense probably benign 0.02
IGL02357:Myo18a APN 11 77850247 missense probably benign 0.02
IGL02420:Myo18a APN 11 77818693 missense possibly damaging 0.81
IGL02643:Myo18a APN 11 77778172 missense possibly damaging 0.67
IGL02667:Myo18a APN 11 77857852 splice site probably benign
IGL02869:Myo18a APN 11 77864786 missense probably damaging 1.00
IGL02869:Myo18a APN 11 77829873 splice site probably benign
IGL02962:Myo18a APN 11 77778235 missense probably damaging 1.00
IGL02963:Myo18a APN 11 77842018 splice site probably benign
IGL03410:Myo18a APN 11 77848004 missense probably damaging 0.99
IGL03050:Myo18a UTSW 11 77818770 missense probably benign 0.00
R0022:Myo18a UTSW 11 77843233 critical splice donor site probably null
R0064:Myo18a UTSW 11 77847344 missense probably damaging 1.00
R0064:Myo18a UTSW 11 77847344 missense probably damaging 1.00
R0098:Myo18a UTSW 11 77845765 missense probably damaging 1.00
R0322:Myo18a UTSW 11 77829800 missense probably damaging 1.00
R0373:Myo18a UTSW 11 77821042 missense probably benign 0.01
R0379:Myo18a UTSW 11 77850806 missense possibly damaging 0.84
R0513:Myo18a UTSW 11 77811594 intron probably benign
R0688:Myo18a UTSW 11 77824140 missense probably damaging 1.00
R0734:Myo18a UTSW 11 77847404 missense probably damaging 1.00
R0790:Myo18a UTSW 11 77840709 missense possibly damaging 0.95
R1099:Myo18a UTSW 11 77818901 splice site probably null
R1103:Myo18a UTSW 11 77823330 missense probably damaging 1.00
R1183:Myo18a UTSW 11 77857745 missense probably damaging 1.00
R1216:Myo18a UTSW 11 77818647 missense probably benign 0.35
R1331:Myo18a UTSW 11 77841579 missense probably benign 0.28
R1479:Myo18a UTSW 11 77842194 missense probably benign 0.04
R1723:Myo18a UTSW 11 77853314 missense probably damaging 0.97
R1742:Myo18a UTSW 11 77841467 missense probably damaging 0.99
R1796:Myo18a UTSW 11 77829344 missense possibly damaging 0.94
R1823:Myo18a UTSW 11 77825097 splice site probably benign
R1827:Myo18a UTSW 11 77818771 missense probably benign 0.00
R2033:Myo18a UTSW 11 77843099 splice site probably null
R2043:Myo18a UTSW 11 77823363 missense probably damaging 0.99
R2105:Myo18a UTSW 11 77850234 missense probably benign
R2191:Myo18a UTSW 11 77818615 missense probably damaging 0.99
R2264:Myo18a UTSW 11 77819972 splice site probably benign
R2370:Myo18a UTSW 11 77777770 missense probably benign 0.03
R3015:Myo18a UTSW 11 77859020 intron probably benign
R3433:Myo18a UTSW 11 77818044 intron probably null
R3739:Myo18a UTSW 11 77845615 missense probably damaging 1.00
R3825:Myo18a UTSW 11 77777466 missense possibly damaging 0.47
R4056:Myo18a UTSW 11 77812013 missense possibly damaging 0.72
R4163:Myo18a UTSW 11 77829708 missense possibly damaging 0.72
R4184:Myo18a UTSW 11 77857787 missense probably damaging 1.00
R4620:Myo18a UTSW 11 77817947 missense possibly damaging 0.93
R4628:Myo18a UTSW 11 77824136 missense probably damaging 1.00
R4647:Myo18a UTSW 11 77817950 missense probably damaging 1.00
R4701:Myo18a UTSW 11 77817665 missense probably damaging 1.00
R4729:Myo18a UTSW 11 77777685 unclassified probably null
R4731:Myo18a UTSW 11 77829759 missense probably benign 0.00
R4739:Myo18a UTSW 11 77823323 missense probably damaging 1.00
R4814:Myo18a UTSW 11 77859236 intron probably benign
R4889:Myo18a UTSW 11 77832412 missense probably damaging 1.00
R4988:Myo18a UTSW 11 77845521 critical splice donor site probably null
R5172:Myo18a UTSW 11 77824098 missense probably damaging 1.00
R5177:Myo18a UTSW 11 77864842 utr 3 prime probably benign
R5394:Myo18a UTSW 11 77853350 missense probably benign 0.14
R5643:Myo18a UTSW 11 77854687 missense probably benign 0.12
R5808:Myo18a UTSW 11 77829301 missense probably benign 0.34
R5871:Myo18a UTSW 11 77832480 missense probably damaging 1.00
R5936:Myo18a UTSW 11 77818213 missense probably damaging 1.00
R6017:Myo18a UTSW 11 77841523 missense probably damaging 0.96
R6053:Myo18a UTSW 11 77818176 missense probably damaging 1.00
R6271:Myo18a UTSW 11 77820809 missense probably damaging 1.00
R6486:Myo18a UTSW 11 77864822 missense possibly damaging 0.83
R6558:Myo18a UTSW 11 77850852 missense probably damaging 0.99
R6884:Myo18a UTSW 11 77819049 missense possibly damaging 0.67
R6983:Myo18a UTSW 11 77845515 missense probably benign 0.06
R6993:Myo18a UTSW 11 77859074 intron probably benign
R7071:Myo18a UTSW 11 77823827 missense probably damaging 1.00
R7074:Myo18a UTSW 11 77842561 missense probably benign 0.03
R7238:Myo18a UTSW 11 77842233 missense probably damaging 0.96
R7328:Myo18a UTSW 11 77807911 missense
R7527:Myo18a UTSW 11 77843580 missense probably benign 0.00
R7598:Myo18a UTSW 11 77847346 missense probably damaging 1.00
R8098:Myo18a UTSW 11 77845401 missense probably damaging 0.97
Y5407:Myo18a UTSW 11 77777815 missense probably benign 0.44
Z1177:Myo18a UTSW 11 77841995 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACCCTGAAGGACTCCATC -3'
(R):5'- CCAGTGATGGATGGCTGAAC -3'

Sequencing Primer
(F):5'- TGCCACCTCTCCTGAAAGG -3'
(R):5'- CTGAACTGTGAGTGTGCCTC -3'
Posted On2019-11-12