Incidental Mutation 'R7671:Myo18a'
ID 592172
Institutional Source Beutler Lab
Gene Symbol Myo18a
Ensembl Gene ENSMUSG00000000631
Gene Name myosin XVIIIA
Synonyms MyoPDZ
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7671 (G1)
Quality Score 137.008
Status Not validated
Chromosome 11
Chromosomal Location 77654072-77756806 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 77750246 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 199 (R199H)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000645] [ENSMUST00000092884] [ENSMUST00000092887] [ENSMUST00000100794] [ENSMUST00000102488] [ENSMUST00000108375] [ENSMUST00000108376] [ENSMUST00000130305] [ENSMUST00000130627] [ENSMUST00000164334] [ENSMUST00000167856] [ENSMUST00000168348] [ENSMUST00000169105] [ENSMUST00000172303]
AlphaFold Q9JMH9
Predicted Effect probably benign
Transcript: ENSMUST00000000645
SMART Domains Protein: ENSMUSP00000000645
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 399 1183 1.53e-45 SMART
IQ 1184 1206 1.11e-3 SMART
Pfam:Myosin_tail_1 1219 1867 1.7e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092884
SMART Domains Protein: ENSMUSP00000090560
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
MYSc 68 851 4.16e-47 SMART
IQ 852 874 1.11e-3 SMART
Pfam:Myosin_tail_1 888 1534 2e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092887
SMART Domains Protein: ENSMUSP00000090563
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 399 1182 4.16e-47 SMART
IQ 1183 1205 1.11e-3 SMART
Pfam:Myosin_tail_1 1218 1866 3e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100794
SMART Domains Protein: ENSMUSP00000098358
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
MYSc 68 847 1.45e-46 SMART
IQ 848 870 1.11e-3 SMART
Pfam:Myosin_tail_1 884 1530 4.9e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102488
SMART Domains Protein: ENSMUSP00000099546
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 399 1182 4.16e-47 SMART
IQ 1183 1205 1.11e-3 SMART
Pfam:Myosin_tail_1 1218 1866 3e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108375
SMART Domains Protein: ENSMUSP00000104012
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 399 1182 4.16e-47 SMART
IQ 1183 1205 1.11e-3 SMART
Pfam:Myosin_tail_1 1218 1838 6.8e-36 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000117044
Gene: ENSMUSG00000000631
AA Change: R199H

DomainStartEndE-ValueType
low complexity region 198 231 N/A INTRINSIC
low complexity region 289 303 N/A INTRINSIC
low complexity region 361 459 N/A INTRINSIC
low complexity region 474 486 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108376
SMART Domains Protein: ENSMUSP00000104013
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 399 1182 4.16e-47 SMART
IQ 1183 1205 1.11e-3 SMART
Blast:MYSc 1258 1387 1e-14 BLAST
low complexity region 1396 1407 N/A INTRINSIC
low complexity region 1743 1762 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130305
SMART Domains Protein: ENSMUSP00000119574
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
MYSc 80 863 4.16e-47 SMART
IQ 864 886 1.11e-3 SMART
Pfam:Myosin_tail_1 902 1547 2.6e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130627
SMART Domains Protein: ENSMUSP00000119839
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 411 1194 4.16e-47 SMART
IQ 1195 1217 1.11e-3 SMART
Pfam:Myosin_tail_1 1230 1850 6.9e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164334
SMART Domains Protein: ENSMUSP00000131771
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
MYSc 68 851 4.16e-47 SMART
IQ 852 874 1.11e-3 SMART
Pfam:Myosin_tail_1 888 1505 4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167856
SMART Domains Protein: ENSMUSP00000128487
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
MYSc 16 789 1.3e-32 SMART
IQ 790 812 1.11e-3 SMART
Blast:MYSc 865 994 1e-14 BLAST
low complexity region 1003 1014 N/A INTRINSIC
low complexity region 1387 1406 N/A INTRINSIC
internal_repeat_1 1569 1627 2.13e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000168348
SMART Domains Protein: ENSMUSP00000130696
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 447 1230 4.16e-47 SMART
IQ 1231 1253 1.11e-3 SMART
Blast:MYSc 1306 1435 1e-14 BLAST
low complexity region 1444 1455 N/A INTRINSIC
low complexity region 1828 1847 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169105
SMART Domains Protein: ENSMUSP00000132149
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 411 1194 4.16e-47 SMART
IQ 1195 1217 1.11e-3 SMART
Pfam:Myosin_tail_1 1230 1878 7.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172303
SMART Domains Protein: ENSMUSP00000129098
Gene: ENSMUSG00000000631

DomainStartEndE-ValueType
MYSc 80 863 4.16e-47 SMART
IQ 864 886 1.11e-3 SMART
Pfam:Myosin_tail_1 902 1547 2.6e-34 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene can bind GOLPH3, linking the Golgi to the cytoskeleton and influencing Golgi membrane trafficking. The encoded protein is also part of a complex that assembles lamellar actomyosin bundles and may be required for cell migration. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 C A 7: 75,219,648 (GRCm39) T17K probably damaging Het
Ankrd29 T A 18: 12,394,043 (GRCm39) K257I probably damaging Het
Bicc1 A G 10: 70,792,997 (GRCm39) L219P probably benign Het
Bltp1 T C 3: 36,997,380 (GRCm39) F1146L probably damaging Het
Boc C T 16: 44,312,212 (GRCm39) V617M Het
Ccl8 A G 11: 82,006,033 (GRCm39) probably benign Het
Col18a1 A G 10: 76,921,217 (GRCm39) L261P unknown Het
Col5a3 T A 9: 20,686,382 (GRCm39) probably null Het
Cryba4 A C 5: 112,396,039 (GRCm39) probably null Het
Csf2rb A G 15: 78,223,130 (GRCm39) Y114C probably damaging Het
Ctif T C 18: 75,605,087 (GRCm39) D484G probably damaging Het
Ctnnal1 A G 4: 56,837,848 (GRCm39) F261L probably damaging Het
Defb22 A T 2: 152,327,950 (GRCm39) N78K unknown Het
Dele1 T A 18: 38,392,978 (GRCm39) I394N probably damaging Het
Efr3a G A 15: 65,709,283 (GRCm39) probably null Het
Elp4 G T 2: 105,734,826 (GRCm39) A3E probably damaging Het
Emilin2 A G 17: 71,580,905 (GRCm39) V607A probably benign Het
Epsti1 A G 14: 78,141,930 (GRCm39) Y2C probably damaging Het
Fam81b A C 13: 76,419,412 (GRCm39) L46R probably damaging Het
Fam81b G T 13: 76,419,413 (GRCm39) L46I possibly damaging Het
Fbxo15 T A 18: 84,982,278 (GRCm39) H288Q probably damaging Het
Gabrg1 T A 5: 70,973,323 (GRCm39) N77I probably damaging Het
Ganab A G 19: 8,890,216 (GRCm39) Y715C possibly damaging Het
H2bc27 T C 11: 58,840,102 (GRCm39) S113P possibly damaging Het
Iqgap2 T C 13: 95,764,627 (GRCm39) D1539G probably damaging Het
Kcp T C 6: 29,496,516 (GRCm39) N633S probably benign Het
Krt6a C A 15: 101,598,978 (GRCm39) S529I unknown Het
Leo1 A G 9: 75,352,844 (GRCm39) H129R probably benign Het
Lmf1 G A 17: 25,798,323 (GRCm39) V55M possibly damaging Het
Mcm9 A G 10: 53,413,665 (GRCm39) S472P probably benign Het
Med27 T A 2: 29,267,950 (GRCm39) V33D Het
Mgat4f T C 1: 134,317,800 (GRCm39) C191R probably benign Het
Mup15 C T 4: 61,356,526 (GRCm39) E80K probably benign Het
Nebl T A 2: 17,395,727 (GRCm39) R558* probably null Het
Or10ak8 A T 4: 118,774,183 (GRCm39) H160Q probably benign Het
Or11g7 G T 14: 50,691,342 (GRCm39) V278L probably benign Het
Or12e9 A G 2: 87,202,613 (GRCm39) T246A probably damaging Het
Or4a79 A T 2: 89,551,603 (GRCm39) I284K probably damaging Het
Or5p78 T C 7: 108,212,198 (GRCm39) I228T probably damaging Het
Or6c217 T C 10: 129,738,222 (GRCm39) D119G probably damaging Het
Or8b41 A T 9: 38,054,736 (GRCm39) M97L probably benign Het
Pde11a A T 2: 76,045,697 (GRCm39) F376I possibly damaging Het
Prima1 A T 12: 103,201,920 (GRCm39) C52S probably damaging Het
Pxn G A 5: 115,686,606 (GRCm39) R366H not run Het
Sgce T C 6: 4,691,564 (GRCm39) Y337C probably damaging Het
Slc25a10 T A 11: 120,386,286 (GRCm39) M130K probably benign Het
Slc29a2 A T 19: 5,074,290 (GRCm39) N5I probably benign Het
Slc35a1 A T 4: 34,673,875 (GRCm39) H150Q Het
Slc5a4a T A 10: 75,983,384 (GRCm39) V7D unknown Het
Stk17b T A 1: 53,805,159 (GRCm39) D134V probably damaging Het
Tex55 C T 16: 38,648,453 (GRCm39) D219N possibly damaging Het
Thbs3 T A 3: 89,124,014 (GRCm39) S36T probably benign Het
Thsd4 A G 9: 60,335,457 (GRCm39) S152P probably benign Het
Tmem67 G T 4: 12,063,698 (GRCm39) H422N probably benign Het
Tram1 C A 1: 13,659,868 (GRCm39) V27F probably damaging Het
Trim14 A G 4: 46,507,238 (GRCm39) V326A possibly damaging Het
Other mutations in Myo18a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Myo18a APN 11 77,738,764 (GRCm39) missense probably damaging 1.00
IGL00753:Myo18a APN 11 77,715,977 (GRCm39) missense probably damaging 1.00
IGL01137:Myo18a APN 11 77,718,655 (GRCm39) missense probably damaging 1.00
IGL01536:Myo18a APN 11 77,711,677 (GRCm39) missense probably damaging 1.00
IGL01642:Myo18a APN 11 77,755,558 (GRCm39) missense probably benign 0.07
IGL01728:Myo18a APN 11 77,668,682 (GRCm39) missense probably damaging 0.99
IGL01780:Myo18a APN 11 77,741,073 (GRCm39) missense probably benign 0.02
IGL02286:Myo18a APN 11 77,668,811 (GRCm39) nonsense probably null
IGL02350:Myo18a APN 11 77,741,073 (GRCm39) missense probably benign 0.02
IGL02357:Myo18a APN 11 77,741,073 (GRCm39) missense probably benign 0.02
IGL02420:Myo18a APN 11 77,709,519 (GRCm39) missense possibly damaging 0.81
IGL02643:Myo18a APN 11 77,668,998 (GRCm39) missense possibly damaging 0.67
IGL02667:Myo18a APN 11 77,748,678 (GRCm39) splice site probably benign
IGL02869:Myo18a APN 11 77,720,699 (GRCm39) splice site probably benign
IGL02869:Myo18a APN 11 77,755,612 (GRCm39) missense probably damaging 1.00
IGL02962:Myo18a APN 11 77,669,061 (GRCm39) missense probably damaging 1.00
IGL02963:Myo18a APN 11 77,732,844 (GRCm39) splice site probably benign
IGL03410:Myo18a APN 11 77,738,830 (GRCm39) missense probably damaging 0.99
IGL03050:Myo18a UTSW 11 77,709,596 (GRCm39) missense probably benign 0.00
R0022:Myo18a UTSW 11 77,734,059 (GRCm39) critical splice donor site probably null
R0064:Myo18a UTSW 11 77,738,170 (GRCm39) missense probably damaging 1.00
R0064:Myo18a UTSW 11 77,738,170 (GRCm39) missense probably damaging 1.00
R0098:Myo18a UTSW 11 77,736,591 (GRCm39) missense probably damaging 1.00
R0322:Myo18a UTSW 11 77,720,626 (GRCm39) missense probably damaging 1.00
R0373:Myo18a UTSW 11 77,711,868 (GRCm39) missense probably benign 0.01
R0379:Myo18a UTSW 11 77,741,632 (GRCm39) missense possibly damaging 0.84
R0513:Myo18a UTSW 11 77,702,420 (GRCm39) intron probably benign
R0688:Myo18a UTSW 11 77,714,966 (GRCm39) missense probably damaging 1.00
R0734:Myo18a UTSW 11 77,738,230 (GRCm39) missense probably damaging 1.00
R0790:Myo18a UTSW 11 77,731,535 (GRCm39) missense possibly damaging 0.95
R1099:Myo18a UTSW 11 77,709,727 (GRCm39) splice site probably null
R1103:Myo18a UTSW 11 77,714,156 (GRCm39) missense probably damaging 1.00
R1183:Myo18a UTSW 11 77,748,571 (GRCm39) missense probably damaging 1.00
R1216:Myo18a UTSW 11 77,709,473 (GRCm39) missense probably benign 0.35
R1331:Myo18a UTSW 11 77,732,405 (GRCm39) missense probably benign 0.28
R1479:Myo18a UTSW 11 77,733,020 (GRCm39) missense probably benign 0.04
R1723:Myo18a UTSW 11 77,744,140 (GRCm39) missense probably damaging 0.97
R1742:Myo18a UTSW 11 77,732,293 (GRCm39) missense probably damaging 0.99
R1796:Myo18a UTSW 11 77,720,170 (GRCm39) missense possibly damaging 0.94
R1823:Myo18a UTSW 11 77,715,923 (GRCm39) splice site probably benign
R1827:Myo18a UTSW 11 77,709,597 (GRCm39) missense probably benign 0.00
R2033:Myo18a UTSW 11 77,733,925 (GRCm39) splice site probably null
R2043:Myo18a UTSW 11 77,714,189 (GRCm39) missense probably damaging 0.99
R2105:Myo18a UTSW 11 77,741,060 (GRCm39) missense probably benign
R2191:Myo18a UTSW 11 77,709,441 (GRCm39) missense probably damaging 0.99
R2264:Myo18a UTSW 11 77,710,798 (GRCm39) splice site probably benign
R2370:Myo18a UTSW 11 77,668,596 (GRCm39) missense probably benign 0.03
R3015:Myo18a UTSW 11 77,749,846 (GRCm39) intron probably benign
R3433:Myo18a UTSW 11 77,708,870 (GRCm39) splice site probably null
R3739:Myo18a UTSW 11 77,736,441 (GRCm39) missense probably damaging 1.00
R3825:Myo18a UTSW 11 77,668,292 (GRCm39) missense possibly damaging 0.47
R4056:Myo18a UTSW 11 77,702,839 (GRCm39) missense possibly damaging 0.72
R4163:Myo18a UTSW 11 77,720,534 (GRCm39) missense possibly damaging 0.72
R4184:Myo18a UTSW 11 77,748,613 (GRCm39) missense probably damaging 1.00
R4620:Myo18a UTSW 11 77,708,773 (GRCm39) missense possibly damaging 0.93
R4628:Myo18a UTSW 11 77,714,962 (GRCm39) missense probably damaging 1.00
R4647:Myo18a UTSW 11 77,708,776 (GRCm39) missense probably damaging 1.00
R4701:Myo18a UTSW 11 77,708,491 (GRCm39) missense probably damaging 1.00
R4729:Myo18a UTSW 11 77,668,511 (GRCm39) splice site probably null
R4731:Myo18a UTSW 11 77,720,585 (GRCm39) missense probably benign 0.00
R4739:Myo18a UTSW 11 77,714,149 (GRCm39) missense probably damaging 1.00
R4814:Myo18a UTSW 11 77,750,062 (GRCm39) intron probably benign
R4889:Myo18a UTSW 11 77,723,238 (GRCm39) missense probably damaging 1.00
R4988:Myo18a UTSW 11 77,736,347 (GRCm39) critical splice donor site probably null
R5172:Myo18a UTSW 11 77,714,924 (GRCm39) missense probably damaging 1.00
R5177:Myo18a UTSW 11 77,755,668 (GRCm39) utr 3 prime probably benign
R5394:Myo18a UTSW 11 77,744,176 (GRCm39) missense probably benign 0.14
R5643:Myo18a UTSW 11 77,745,513 (GRCm39) missense probably benign 0.12
R5808:Myo18a UTSW 11 77,720,127 (GRCm39) missense probably benign 0.34
R5871:Myo18a UTSW 11 77,723,306 (GRCm39) missense probably damaging 1.00
R5936:Myo18a UTSW 11 77,709,039 (GRCm39) missense probably damaging 1.00
R6017:Myo18a UTSW 11 77,732,349 (GRCm39) missense probably damaging 0.96
R6053:Myo18a UTSW 11 77,709,002 (GRCm39) missense probably damaging 1.00
R6271:Myo18a UTSW 11 77,711,635 (GRCm39) missense probably damaging 1.00
R6486:Myo18a UTSW 11 77,755,648 (GRCm39) missense possibly damaging 0.83
R6558:Myo18a UTSW 11 77,741,678 (GRCm39) missense probably damaging 0.99
R6884:Myo18a UTSW 11 77,709,875 (GRCm39) missense possibly damaging 0.67
R6983:Myo18a UTSW 11 77,736,341 (GRCm39) missense probably benign 0.06
R6993:Myo18a UTSW 11 77,749,900 (GRCm39) intron probably benign
R7071:Myo18a UTSW 11 77,714,653 (GRCm39) missense probably damaging 1.00
R7074:Myo18a UTSW 11 77,733,387 (GRCm39) missense probably benign 0.03
R7238:Myo18a UTSW 11 77,733,059 (GRCm39) missense probably damaging 0.96
R7328:Myo18a UTSW 11 77,698,737 (GRCm39) missense
R7527:Myo18a UTSW 11 77,734,406 (GRCm39) missense probably benign 0.00
R7598:Myo18a UTSW 11 77,738,172 (GRCm39) missense probably damaging 1.00
R7958:Myo18a UTSW 11 77,732,383 (GRCm39) missense probably damaging 1.00
R8098:Myo18a UTSW 11 77,736,227 (GRCm39) missense probably damaging 0.97
R8168:Myo18a UTSW 11 77,711,968 (GRCm39) missense probably damaging 0.99
R8318:Myo18a UTSW 11 77,714,215 (GRCm39) missense probably benign 0.02
R8685:Myo18a UTSW 11 77,745,520 (GRCm39) missense probably benign 0.00
R8778:Myo18a UTSW 11 77,714,150 (GRCm39) missense probably damaging 1.00
R9023:Myo18a UTSW 11 77,718,477 (GRCm39) missense probably damaging 1.00
R9059:Myo18a UTSW 11 77,668,899 (GRCm39) missense possibly damaging 0.78
R9186:Myo18a UTSW 11 77,749,847 (GRCm39) missense
R9321:Myo18a UTSW 11 77,733,370 (GRCm39) missense probably damaging 0.97
R9357:Myo18a UTSW 11 77,733,014 (GRCm39) missense probably damaging 1.00
R9407:Myo18a UTSW 11 77,709,596 (GRCm39) missense probably benign 0.00
R9430:Myo18a UTSW 11 77,709,410 (GRCm39) missense possibly damaging 0.64
R9576:Myo18a UTSW 11 77,709,827 (GRCm39) missense probably damaging 1.00
R9585:Myo18a UTSW 11 77,709,495 (GRCm39) missense probably benign 0.06
R9698:Myo18a UTSW 11 77,720,681 (GRCm39) missense probably damaging 0.99
R9743:Myo18a UTSW 11 77,723,304 (GRCm39) missense probably benign 0.10
R9777:Myo18a UTSW 11 77,733,080 (GRCm39) missense possibly damaging 0.94
Y5407:Myo18a UTSW 11 77,668,641 (GRCm39) missense probably benign 0.44
Z1177:Myo18a UTSW 11 77,732,821 (GRCm39) missense probably damaging 1.00
Z1187:Myo18a UTSW 11 77,744,643 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCACCCTGAAGGACTCCATC -3'
(R):5'- CCAGTGATGGATGGCTGAAC -3'

Sequencing Primer
(F):5'- TGCCACCTCTCCTGAAAGG -3'
(R):5'- CTGAACTGTGAGTGTGCCTC -3'
Posted On 2019-11-12