Mutagenetix > Incidental Mutations

Incidental Mutation 'R7671:Iqgap2'

592178

Institutional Source

Beutler Lab

Gene Symbol

Iqgap2

Ensembl Gene

ENSMUSG00000021676

Gene Name

IQ motif containing GTPase activating protein 2

Synonyms

4933417J23Rik

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7671 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

95627177-95891922 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 95628119 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1539 (D1539G)

Ref Sequence

ENSEMBL: ENSMUSP00000067685 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068603]

AlphaFold

Q3UQ44

Predicted Effect

probably damaging
Transcript: ENSMUST00000068603
AA Change: D1539G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000067685
Gene: ENSMUSG00000021676
AA Change: D1539G

Domain	Start	End	E-Value	Type
CH	43	152	3.32e-16	SMART
coiled coil region	253	276	N/A	INTRINSIC
low complexity region	469	480	N/A	INTRINSIC
IQ	689	711	1.38e-4	SMART
IQ	719	741	7.36e0	SMART
IQ	749	771	2.43e1	SMART
coiled coil region	799	828	N/A	INTRINSIC
RasGAP	905	1258	2.6e-120	SMART
Pfam:RasGAP_C	1367	1498	3.2e-40	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IQGAP family. The protein contains three IQ domains, one calponin homology domain, one Ras-GAP domain and one WW domain. It interacts with components of the cytoskeleton, with cell adhesion molecules, and with several signaling molecules to regulate cell morphology and motility. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display reduced survival with increased incidence of hepatocellular carcinomas, increased hepatocyte apoptosis, and hepatocyte mitochondrial abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	T	A	18: 38,259,925	I394N	probably damaging	Het
4930435E12Rik	C	T	16: 38,828,091	D219N	possibly damaging	Het
4932438A13Rik	T	C	3: 36,943,231	F1146L	probably damaging	Het
4933406M09Rik	T	C	1: 134,390,062	C191R	probably benign	Het
Akap13	C	A	7: 75,569,900	T17K	probably damaging	Het
Ankrd29	T	A	18: 12,260,986	K257I	probably damaging	Het
Bicc1	A	G	10: 70,957,167	L219P	probably benign	Het
Boc	C	T	16: 44,491,849	V617M		Het
Ccl8	A	G	11: 82,115,207		probably benign	Het
Col18a1	A	G	10: 77,085,383	L261P	unknown	Het
Col5a3	T	A	9: 20,775,086		probably null	Het
Cryba4	A	C	5: 112,248,173		probably null	Het
Csf2rb	A	G	15: 78,338,930	Y114C	probably damaging	Het
Ctif	T	C	18: 75,472,016	D484G	probably damaging	Het
Ctnnal1	A	G	4: 56,837,848	F261L	probably damaging	Het
Defb22	A	T	2: 152,486,030	N78K	unknown	Het
Efr3a	G	A	15: 65,837,434		probably null	Het
Elp4	G	T	2: 105,904,481	A3E	probably damaging	Het
Emilin2	A	G	17: 71,273,910	V607A	probably benign	Het
Epsti1	A	G	14: 77,904,490	Y2C	probably damaging	Het
Fam81b	A	C	13: 76,271,293	L46R	probably damaging	Het
Fam81b	G	T	13: 76,271,294	L46I	possibly damaging	Het
Fbxo15	T	A	18: 84,964,153	H288Q	probably damaging	Het
Gabrg1	T	A	5: 70,815,980	N77I	probably damaging	Het
Ganab	A	G	19: 8,912,852	Y715C	possibly damaging	Het
Hist3h2ba	T	C	11: 58,949,276	S113P	possibly damaging	Het
Kcp	T	C	6: 29,496,517	N633S	probably benign	Het
Krt6a	C	A	15: 101,690,543	S529I	unknown	Het
Leo1	A	G	9: 75,445,562	H129R	probably benign	Het
Lmf1	G	A	17: 25,579,349	V55M	possibly damaging	Het
Mcm9	A	G	10: 53,537,569	S472P	probably benign	Het
Med27	T	A	2: 29,377,938	V33D		Het
Mup15	C	T	4: 61,438,289	E80K	probably benign	Het
Myo18a	G	A	11: 77,859,420	R199H		Het
Nebl	T	A	2: 17,390,916	R558*	probably null	Het
Olfr1121	A	G	2: 87,372,269	T246A	probably damaging	Het
Olfr1252	A	T	2: 89,721,259	I284K	probably damaging	Het
Olfr1329	A	T	4: 118,916,986	H160Q	probably benign	Het
Olfr506	T	C	7: 108,612,991	I228T	probably damaging	Het
Olfr740	G	T	14: 50,453,885	V278L	probably benign	Het
Olfr815	T	C	10: 129,902,353	D119G	probably damaging	Het
Olfr890	A	T	9: 38,143,440	M97L	probably benign	Het
Pde11a	A	T	2: 76,215,353	F376I	possibly damaging	Het
Prima1	A	T	12: 103,235,661	C52S	probably damaging	Het
Pxn	G	A	5: 115,548,547	R366H	not run	Het
Sgce	T	C	6: 4,691,564	Y337C	probably damaging	Het
Slc25a10	T	A	11: 120,495,460	M130K	probably benign	Het
Slc29a2	A	T	19: 5,024,262	N5I	probably benign	Het
Slc35a1	A	T	4: 34,673,875	H150Q		Het
Slc5a4a	T	A	10: 76,147,550	V7D	unknown	Het
Stk17b	T	A	1: 53,766,000	D134V	probably damaging	Het
Thbs3	T	A	3: 89,216,707	S36T	probably benign	Het
Thsd4	A	G	9: 60,428,174	S152P	probably benign	Het
Tmem67	G	T	4: 12,063,698	H422N	probably benign	Het
Tram1	C	A	1: 13,589,644	V27F	probably damaging	Het
Trim14	A	G	4: 46,507,238	V326A	possibly damaging	Het

Other mutations in Iqgap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00799:Iqgap2	APN	13	95657944	splice site	probably benign
IGL01968:Iqgap2	APN	13	95635582	missense	possibly damaging	0.80
IGL02049:Iqgap2	APN	13	95675405	splice site	probably benign
IGL02195:Iqgap2	APN	13	95661734	splice site	probably benign
IGL02387:Iqgap2	APN	13	95689701	missense	probably benign	0.00
IGL02634:Iqgap2	APN	13	95628114	missense	probably damaging	1.00
IGL02666:Iqgap2	APN	13	95628056	missense	probably damaging	1.00
IGL02685:Iqgap2	APN	13	95671404	missense	probably damaging	1.00
IGL02927:Iqgap2	APN	13	95724676	missense	possibly damaging	0.62
IGL02943:Iqgap2	APN	13	95661735	splice site	probably benign
IGL03167:Iqgap2	APN	13	95684898	missense	probably benign	0.34
IGL03169:Iqgap2	APN	13	95731277	splice site	probably null
IGL03293:Iqgap2	APN	13	95731434	missense	probably damaging	1.00
G1Funyon:Iqgap2	UTSW	13	95682151	critical splice donor site	probably null
R0257:Iqgap2	UTSW	13	95724544	critical splice donor site	probably null
R0335:Iqgap2	UTSW	13	95635633	missense	probably damaging	0.99
R0360:Iqgap2	UTSW	13	95731275	splice site	probably benign
R0364:Iqgap2	UTSW	13	95731275	splice site	probably benign
R0419:Iqgap2	UTSW	13	95689699	critical splice donor site	probably null
R1229:Iqgap2	UTSW	13	95632165	missense	probably benign	0.32
R1290:Iqgap2	UTSW	13	95668513	missense	probably damaging	1.00
R1397:Iqgap2	UTSW	13	95632165	missense	probably benign	0.32
R1498:Iqgap2	UTSW	13	95646805	missense	probably benign
R1513:Iqgap2	UTSW	13	95630010	missense	probably damaging	1.00
R1630:Iqgap2	UTSW	13	95689785	missense	probably benign
R2088:Iqgap2	UTSW	13	95891663	critical splice donor site	probably null
R2928:Iqgap2	UTSW	13	95682236	missense	probably benign
R3026:Iqgap2	UTSW	13	95673056	critical splice acceptor site	probably null
R3720:Iqgap2	UTSW	13	95668528	splice site	probably null
R3846:Iqgap2	UTSW	13	95673678	splice site	probably benign
R4056:Iqgap2	UTSW	13	95750033	missense	probably damaging	1.00
R4077:Iqgap2	UTSW	13	95657867	missense	probably damaging	1.00
R4353:Iqgap2	UTSW	13	95671396	missense	probably damaging	1.00
R4517:Iqgap2	UTSW	13	95664061	critical splice donor site	probably null
R4628:Iqgap2	UTSW	13	95763329	missense	probably benign	0.17
R4686:Iqgap2	UTSW	13	95721609	missense	probably damaging	0.98
R4724:Iqgap2	UTSW	13	95635497	missense	possibly damaging	0.73
R4826:Iqgap2	UTSW	13	95763275	missense	probably damaging	1.00
R4847:Iqgap2	UTSW	13	95673743	missense	probably benign	0.19
R4967:Iqgap2	UTSW	13	95630006	missense	probably benign	0.00
R4973:Iqgap2	UTSW	13	95657797	splice site	probably null
R5010:Iqgap2	UTSW	13	95673743	missense	probably benign	0.19
R5086:Iqgap2	UTSW	13	95635580	missense	probably benign	0.01
R5496:Iqgap2	UTSW	13	95630053	missense	probably damaging	1.00
R5512:Iqgap2	UTSW	13	95675376	nonsense	probably null
R5629:Iqgap2	UTSW	13	95632174	missense	probably damaging	1.00
R5824:Iqgap2	UTSW	13	95675372	missense	probably damaging	0.99
R5830:Iqgap2	UTSW	13	95675372	missense	probably damaging	0.99
R5831:Iqgap2	UTSW	13	95675372	missense	probably damaging	0.99
R5832:Iqgap2	UTSW	13	95675372	missense	probably damaging	0.99
R5833:Iqgap2	UTSW	13	95675372	missense	probably damaging	0.99
R5834:Iqgap2	UTSW	13	95675372	missense	probably damaging	0.99
R5852:Iqgap2	UTSW	13	95675372	missense	probably damaging	0.99
R5888:Iqgap2	UTSW	13	95635610	missense	possibly damaging	0.89
R5889:Iqgap2	UTSW	13	95632042	missense	probably benign	0.00
R6093:Iqgap2	UTSW	13	95628963	missense	probably damaging	0.99
R6141:Iqgap2	UTSW	13	95721686	splice site	probably null
R6404:Iqgap2	UTSW	13	95729477	missense	probably benign	0.28
R6434:Iqgap2	UTSW	13	95682933	missense	possibly damaging	0.85
R6648:Iqgap2	UTSW	13	95682211	missense	probably benign	0.27
R6658:Iqgap2	UTSW	13	95660332	missense	probably damaging	1.00
R6903:Iqgap2	UTSW	13	95661057	missense	probably damaging	1.00
R7223:Iqgap2	UTSW	13	95628972	missense	probably damaging	1.00
R7327:Iqgap2	UTSW	13	95635655	missense	probably benign	0.00
R7371:Iqgap2	UTSW	13	95700338	splice site	probably null
R7378:Iqgap2	UTSW	13	95732890	critical splice donor site	probably null
R7441:Iqgap2	UTSW	13	95628076	missense	probably benign	0.23
R7575:Iqgap2	UTSW	13	95661623	missense	probably damaging	0.99
R7713:Iqgap2	UTSW	13	95731444	missense	probably benign	0.01
R7806:Iqgap2	UTSW	13	95682257	missense	probably benign	0.00
R7893:Iqgap2	UTSW	13	95689709	missense	probably damaging	0.96
R8052:Iqgap2	UTSW	13	95657879	missense	probably damaging	0.96
R8121:Iqgap2	UTSW	13	95724568	missense	probably benign	0.00
R8261:Iqgap2	UTSW	13	95635570	missense	probably damaging	1.00
R8301:Iqgap2	UTSW	13	95682151	critical splice donor site	probably null
R8369:Iqgap2	UTSW	13	95661603	missense	probably damaging	1.00
R8485:Iqgap2	UTSW	13	95660151	missense	probably damaging	0.99
R8709:Iqgap2	UTSW	13	95660205	missense	probably damaging	0.99
R8710:Iqgap2	UTSW	13	95660248	missense	probably benign	0.24
R8737:Iqgap2	UTSW	13	95665750	missense	probably damaging	1.00
R8845:Iqgap2	UTSW	13	95657884	missense	possibly damaging	0.60
R8902:Iqgap2	UTSW	13	95682203	missense	probably benign	0.16
R8957:Iqgap2	UTSW	13	95635646	missense	probably damaging	1.00
R9153:Iqgap2	UTSW	13	95708039	missense	probably benign
R9259:Iqgap2	UTSW	13	95630053	missense	probably damaging	1.00
R9290:Iqgap2	UTSW	13	95750015	missense	probably damaging	1.00
R9414:Iqgap2	UTSW	13	95646841	missense
R9432:Iqgap2	UTSW	13	95637753	missense	probably benign
X0066:Iqgap2	UTSW	13	95671383	missense	probably damaging	0.98
Z1176:Iqgap2	UTSW	13	95731443	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- AGCCCATTTCTCAAGGCAG -3'
(R):5'- GTCATTTTCTTCCACGCAGAG -3'

Sequencing Primer
(F):5'- CATTTCTCAAGGCAGGCAATAG -3'
(R):5'- TAAGTGTGTCCTGACCACAGC -3'

Posted On

2019-11-12