Incidental Mutation 'R7671:Epsti1'
ID592180
Institutional Source Beutler Lab
Gene Symbol Epsti1
Ensembl Gene ENSMUSG00000022014
Gene Nameepithelial stromal interaction 1 (breast)
Synonyms5033415K03Rik, 2310046K10Rik, BRESI1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R7671 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location77904239-78002657 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77904490 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 2 (Y2C)
Ref Sequence ENSEMBL: ENSMUSP00000022591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022591] [ENSMUST00000169978] [ENSMUST00000227903]
Predicted Effect probably damaging
Transcript: ENSMUST00000022591
AA Change: Y2C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000022591
Gene: ENSMUSG00000022014
AA Change: Y2C

DomainStartEndE-ValueType
coiled coil region 111 180 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169978
AA Change: Y2C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000130138
Gene: ENSMUSG00000022014
AA Change: Y2C

DomainStartEndE-ValueType
coiled coil region 111 180 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000227903
AA Change: Y2C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has been shown to promote tumor invasion and metastasis in some invasive cancer cells when overexpressed. Expression of this gene has been shown to be upregulated by direct binding of the Kruppel like factor 8 protein to promoter sequences. The translated protein interacts with the amino terminal region of the valosin containing protein gene product, resulting in the nuclear translocation of the nuclear factor kappa B subunit 1 gene product, and activation of target genes. Overexpression of this gene has been observed in some breast cancers and in some individuals with systemic lupus erythematosus (SLE). [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T A 18: 38,259,925 I394N probably damaging Het
4930435E12Rik C T 16: 38,828,091 D219N possibly damaging Het
4932438A13Rik T C 3: 36,943,231 F1146L probably damaging Het
4933406M09Rik T C 1: 134,390,062 C191R probably benign Het
Akap13 C A 7: 75,569,900 T17K probably damaging Het
Ankrd29 T A 18: 12,260,986 K257I probably damaging Het
Bicc1 A G 10: 70,957,167 L219P probably benign Het
Boc C T 16: 44,491,849 V617M Het
Ccl8 A G 11: 82,115,207 probably benign Het
Col18a1 A G 10: 77,085,383 L261P unknown Het
Col5a3 T A 9: 20,775,086 probably null Het
Cryba4 A C 5: 112,248,173 probably null Het
Csf2rb A G 15: 78,338,930 Y114C probably damaging Het
Ctif T C 18: 75,472,016 D484G probably damaging Het
Ctnnal1 A G 4: 56,837,848 F261L probably damaging Het
Defb22 A T 2: 152,486,030 N78K unknown Het
Efr3a G A 15: 65,837,434 probably null Het
Elp4 G T 2: 105,904,481 A3E probably damaging Het
Emilin2 A G 17: 71,273,910 V607A probably benign Het
Fam81b A C 13: 76,271,293 L46R probably damaging Het
Fam81b G T 13: 76,271,294 L46I possibly damaging Het
Fbxo15 T A 18: 84,964,153 H288Q probably damaging Het
Gabrg1 T A 5: 70,815,980 N77I probably damaging Het
Ganab A G 19: 8,912,852 Y715C possibly damaging Het
Hist3h2ba T C 11: 58,949,276 S113P possibly damaging Het
Iqgap2 T C 13: 95,628,119 D1539G probably damaging Het
Kcp T C 6: 29,496,517 N633S probably benign Het
Krt6a C A 15: 101,690,543 S529I unknown Het
Leo1 A G 9: 75,445,562 H129R probably benign Het
Lmf1 G A 17: 25,579,349 V55M possibly damaging Het
Mcm9 A G 10: 53,537,569 S472P probably benign Het
Med27 T A 2: 29,377,938 V33D Het
Mup15 C T 4: 61,438,289 E80K probably benign Het
Myo18a G A 11: 77,859,420 R199H Het
Nebl T A 2: 17,390,916 R558* probably null Het
Olfr1121 A G 2: 87,372,269 T246A probably damaging Het
Olfr1252 A T 2: 89,721,259 I284K probably damaging Het
Olfr1329 A T 4: 118,916,986 H160Q probably benign Het
Olfr506 T C 7: 108,612,991 I228T probably damaging Het
Olfr740 G T 14: 50,453,885 V278L probably benign Het
Olfr815 T C 10: 129,902,353 D119G probably damaging Het
Olfr890 A T 9: 38,143,440 M97L probably benign Het
Pde11a A T 2: 76,215,353 F376I possibly damaging Het
Prima1 A T 12: 103,235,661 C52S probably damaging Het
Pxn G A 5: 115,548,547 R366H not run Het
Sgce T C 6: 4,691,564 Y337C probably damaging Het
Slc25a10 T A 11: 120,495,460 M130K probably benign Het
Slc29a2 A T 19: 5,024,262 N5I probably benign Het
Slc35a1 A T 4: 34,673,875 H150Q Het
Slc5a4a T A 10: 76,147,550 V7D unknown Het
Stk17b T A 1: 53,766,000 D134V probably damaging Het
Thbs3 T A 3: 89,216,707 S36T probably benign Het
Thsd4 A G 9: 60,428,174 S152P probably benign Het
Tmem67 G T 4: 12,063,698 H422N probably benign Het
Tram1 C A 1: 13,589,644 V27F probably damaging Het
Trim14 A G 4: 46,507,238 V326A possibly damaging Het
Other mutations in Epsti1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01787:Epsti1 APN 14 77972612 critical splice donor site probably null
IGL02749:Epsti1 APN 14 77939923 missense probably damaging 1.00
IGL03031:Epsti1 APN 14 77974581 missense probably benign 0.00
R0302:Epsti1 UTSW 14 77939926 missense probably damaging 0.97
R0605:Epsti1 UTSW 14 77927237 splice site probably benign
R0743:Epsti1 UTSW 14 77931275 missense probably damaging 1.00
R0884:Epsti1 UTSW 14 77931275 missense probably damaging 1.00
R1986:Epsti1 UTSW 14 77932233 critical splice donor site probably null
R3162:Epsti1 UTSW 14 77974513 splice site probably benign
R5118:Epsti1 UTSW 14 77986682 splice site probably null
R5296:Epsti1 UTSW 14 77904650 missense probably benign 0.03
R5392:Epsti1 UTSW 14 77986744 missense probably benign 0.00
R5664:Epsti1 UTSW 14 77963664 missense possibly damaging 0.73
R5948:Epsti1 UTSW 14 77939890 missense probably damaging 1.00
R6402:Epsti1 UTSW 14 77939878 missense probably damaging 0.98
R7494:Epsti1 UTSW 14 77928754 missense probably benign 0.10
R7520:Epsti1 UTSW 14 77963443 splice site probably null
R8039:Epsti1 UTSW 14 77931301 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGAGGAAGTTCTCTGAACCCAG -3'
(R):5'- GCCTGATTATATTCGGGAACAGG -3'

Sequencing Primer
(F):5'- CCCAGCGGGTGGTTAAAG -3'
(R):5'- ATATTCGGGAACAGGACTTCC -3'
Posted On2019-11-12