Incidental Mutation 'R7671:Efr3a'
ID 592181
Institutional Source Beutler Lab
Gene Symbol Efr3a
Ensembl Gene ENSMUSG00000015002
Gene Name EFR3 homolog A
Synonyms A130089M23Rik, D030063F01Rik, C920006C10Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.420) question?
Stock # R7671 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 65787034-65873816 bp(+) (GRCm38)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) G to A at 65837434 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000015146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015146] [ENSMUST00000015146] [ENSMUST00000173858] [ENSMUST00000211878]
AlphaFold Q8BG67
Predicted Effect probably null
Transcript: ENSMUST00000015146
SMART Domains Protein: ENSMUSP00000015146
Gene: ENSMUSG00000015002

DomainStartEndE-ValueType
SCOP:d1gw5a_ 226 584 5e-4 SMART
low complexity region 709 720 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000015146
SMART Domains Protein: ENSMUSP00000015146
Gene: ENSMUSG00000015002

DomainStartEndE-ValueType
SCOP:d1gw5a_ 226 584 5e-4 SMART
low complexity region 709 720 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000173858
SMART Domains Protein: ENSMUSP00000134385
Gene: ENSMUSG00000015002

DomainStartEndE-ValueType
SCOP:d1gw5a_ 226 584 8e-4 SMART
low complexity region 709 720 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000211878
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a complex that plays a role in maintaining an active pool of phosphatidylinositol 4-kinase (PI4K) at the plasma membrane. This protein is thought to be a peripheral membrane protein that associates with the plasma membrane through palmitoylation. Studies indicate that this gene product plays a role in controlling G protein-coupled receptor (GPCR) activity by affecting receptor phosphorylation. Whole exome sequencing studies have implicated mutations in this gene with autism spectrum disorders. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T A 18: 38,259,925 I394N probably damaging Het
4930435E12Rik C T 16: 38,828,091 D219N possibly damaging Het
4932438A13Rik T C 3: 36,943,231 F1146L probably damaging Het
4933406M09Rik T C 1: 134,390,062 C191R probably benign Het
Akap13 C A 7: 75,569,900 T17K probably damaging Het
Ankrd29 T A 18: 12,260,986 K257I probably damaging Het
Bicc1 A G 10: 70,957,167 L219P probably benign Het
Boc C T 16: 44,491,849 V617M Het
Ccl8 A G 11: 82,115,207 probably benign Het
Col18a1 A G 10: 77,085,383 L261P unknown Het
Col5a3 T A 9: 20,775,086 probably null Het
Cryba4 A C 5: 112,248,173 probably null Het
Csf2rb A G 15: 78,338,930 Y114C probably damaging Het
Ctif T C 18: 75,472,016 D484G probably damaging Het
Ctnnal1 A G 4: 56,837,848 F261L probably damaging Het
Defb22 A T 2: 152,486,030 N78K unknown Het
Elp4 G T 2: 105,904,481 A3E probably damaging Het
Emilin2 A G 17: 71,273,910 V607A probably benign Het
Epsti1 A G 14: 77,904,490 Y2C probably damaging Het
Fam81b A C 13: 76,271,293 L46R probably damaging Het
Fam81b G T 13: 76,271,294 L46I possibly damaging Het
Fbxo15 T A 18: 84,964,153 H288Q probably damaging Het
Gabrg1 T A 5: 70,815,980 N77I probably damaging Het
Ganab A G 19: 8,912,852 Y715C possibly damaging Het
Hist3h2ba T C 11: 58,949,276 S113P possibly damaging Het
Iqgap2 T C 13: 95,628,119 D1539G probably damaging Het
Kcp T C 6: 29,496,517 N633S probably benign Het
Krt6a C A 15: 101,690,543 S529I unknown Het
Leo1 A G 9: 75,445,562 H129R probably benign Het
Lmf1 G A 17: 25,579,349 V55M possibly damaging Het
Mcm9 A G 10: 53,537,569 S472P probably benign Het
Med27 T A 2: 29,377,938 V33D Het
Mup15 C T 4: 61,438,289 E80K probably benign Het
Myo18a G A 11: 77,859,420 R199H Het
Nebl T A 2: 17,390,916 R558* probably null Het
Olfr1121 A G 2: 87,372,269 T246A probably damaging Het
Olfr1252 A T 2: 89,721,259 I284K probably damaging Het
Olfr1329 A T 4: 118,916,986 H160Q probably benign Het
Olfr506 T C 7: 108,612,991 I228T probably damaging Het
Olfr740 G T 14: 50,453,885 V278L probably benign Het
Olfr815 T C 10: 129,902,353 D119G probably damaging Het
Olfr890 A T 9: 38,143,440 M97L probably benign Het
Pde11a A T 2: 76,215,353 F376I possibly damaging Het
Prima1 A T 12: 103,235,661 C52S probably damaging Het
Pxn G A 5: 115,548,547 R366H not run Het
Sgce T C 6: 4,691,564 Y337C probably damaging Het
Slc25a10 T A 11: 120,495,460 M130K probably benign Het
Slc29a2 A T 19: 5,024,262 N5I probably benign Het
Slc35a1 A T 4: 34,673,875 H150Q Het
Slc5a4a T A 10: 76,147,550 V7D unknown Het
Stk17b T A 1: 53,766,000 D134V probably damaging Het
Thbs3 T A 3: 89,216,707 S36T probably benign Het
Thsd4 A G 9: 60,428,174 S152P probably benign Het
Tmem67 G T 4: 12,063,698 H422N probably benign Het
Tram1 C A 1: 13,589,644 V27F probably damaging Het
Trim14 A G 4: 46,507,238 V326A possibly damaging Het
Other mutations in Efr3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00642:Efr3a APN 15 65855417 missense possibly damaging 0.66
IGL01070:Efr3a APN 15 65853078 missense probably benign
IGL01366:Efr3a APN 15 65851150 missense probably benign 0.37
IGL01754:Efr3a APN 15 65854720 missense probably damaging 0.96
IGL02121:Efr3a APN 15 65871150 splice site probably benign
BB007:Efr3a UTSW 15 65861740 missense probably benign
BB017:Efr3a UTSW 15 65861740 missense probably benign
R0096:Efr3a UTSW 15 65855441 missense probably damaging 1.00
R0096:Efr3a UTSW 15 65855441 missense probably damaging 1.00
R0139:Efr3a UTSW 15 65845981 missense possibly damaging 0.58
R0449:Efr3a UTSW 15 65842704 missense probably damaging 1.00
R0786:Efr3a UTSW 15 65853551 missense possibly damaging 0.47
R0827:Efr3a UTSW 15 65853551 missense possibly damaging 0.70
R0843:Efr3a UTSW 15 65837423 splice site probably benign
R1433:Efr3a UTSW 15 65869057 intron probably benign
R1572:Efr3a UTSW 15 65854792 critical splice donor site probably null
R2290:Efr3a UTSW 15 65849839 missense probably benign 0.00
R2764:Efr3a UTSW 15 65849770 missense possibly damaging 0.94
R4170:Efr3a UTSW 15 65845982 missense probably damaging 0.98
R4368:Efr3a UTSW 15 65866780 missense possibly damaging 0.82
R4683:Efr3a UTSW 15 65819801 missense probably damaging 1.00
R4797:Efr3a UTSW 15 65857588 missense probably damaging 1.00
R5495:Efr3a UTSW 15 65815409 missense possibly damaging 0.73
R6262:Efr3a UTSW 15 65857474 missense possibly damaging 0.90
R6552:Efr3a UTSW 15 65857490 missense possibly damaging 0.52
R6825:Efr3a UTSW 15 65829830 missense probably benign 0.18
R6833:Efr3a UTSW 15 65842686 missense probably damaging 1.00
R6852:Efr3a UTSW 15 65829830 missense probably benign 0.18
R6853:Efr3a UTSW 15 65829830 missense probably benign 0.18
R6996:Efr3a UTSW 15 65848181 nonsense probably null
R7327:Efr3a UTSW 15 65819778 missense probably damaging 0.98
R7467:Efr3a UTSW 15 65857511 missense possibly damaging 0.65
R7549:Efr3a UTSW 15 65815413 critical splice donor site probably null
R7810:Efr3a UTSW 15 65787173 start gained probably benign
R7830:Efr3a UTSW 15 65829830 missense probably benign 0.18
R7832:Efr3a UTSW 15 65829830 missense probably benign 0.18
R7900:Efr3a UTSW 15 65848135 splice site probably null
R7904:Efr3a UTSW 15 65824678 missense probably damaging 1.00
R7930:Efr3a UTSW 15 65861740 missense probably benign
R8115:Efr3a UTSW 15 65866795 missense probably damaging 1.00
R8244:Efr3a UTSW 15 65815368 missense probably damaging 1.00
R8388:Efr3a UTSW 15 65866822 missense probably benign 0.42
R8859:Efr3a UTSW 15 65854765 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTTAGCTCTGAGCATGCTAAG -3'
(R):5'- GGCAAGTGATGTAGTACATGGTATTC -3'

Sequencing Primer
(F):5'- CTCTGAGCATGCTAAGTTCATG -3'
(R):5'- GGATGCCCAATGTGACCTTCATG -3'
Posted On 2019-11-12