Incidental Mutation 'R7671:Lmf1'
ID 592186
Institutional Source Beutler Lab
Gene Symbol Lmf1
Ensembl Gene ENSMUSG00000002279
Gene Name lipase maturation factor 1
Synonyms Tmem112, 2400010G15Rik
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7671 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 25798059-25881800 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 25798323 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 55 (V55M)
Ref Sequence ENSEMBL: ENSMUSP00000066682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063344] [ENSMUST00000116641] [ENSMUST00000137201]
AlphaFold Q3U3R4
Predicted Effect possibly damaging
Transcript: ENSMUST00000063344
AA Change: V55M

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000066682
Gene: ENSMUSG00000002279
AA Change: V55M

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
transmembrane domain 97 119 N/A INTRINSIC
transmembrane domain 129 151 N/A INTRINSIC
Pfam:LMF1 169 551 2.3e-142 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000116641
AA Change: V55M

PolyPhen 2 Score 0.821 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112340
Gene: ENSMUSG00000002279
AA Change: V55M

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
transmembrane domain 97 119 N/A INTRINSIC
transmembrane domain 129 151 N/A INTRINSIC
Pfam:LMF1 169 553 1.2e-148 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000137201
AA Change: V55M

PolyPhen 2 Score 0.821 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect
SMART Domains Protein: ENSMUSP00000119563
Gene: ENSMUSG00000002279
AA Change: V51M

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
transmembrane domain 94 116 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:LMF1 166 298 2.4e-60 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene resides in the endoplasmic reticulum, and is involved in the maturation and transport of lipoprotein lipase through the secretory pathway. Mutations in this gene are associated with combined lipase deficiency. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mutations in this gene result in neonatal death following progressive cyanosis, combined lipase deficiency, and hypertriglyceridemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 C A 7: 75,219,648 (GRCm39) T17K probably damaging Het
Ankrd29 T A 18: 12,394,043 (GRCm39) K257I probably damaging Het
Bicc1 A G 10: 70,792,997 (GRCm39) L219P probably benign Het
Bltp1 T C 3: 36,997,380 (GRCm39) F1146L probably damaging Het
Boc C T 16: 44,312,212 (GRCm39) V617M Het
Ccl8 A G 11: 82,006,033 (GRCm39) probably benign Het
Col18a1 A G 10: 76,921,217 (GRCm39) L261P unknown Het
Col5a3 T A 9: 20,686,382 (GRCm39) probably null Het
Cryba4 A C 5: 112,396,039 (GRCm39) probably null Het
Csf2rb A G 15: 78,223,130 (GRCm39) Y114C probably damaging Het
Ctif T C 18: 75,605,087 (GRCm39) D484G probably damaging Het
Ctnnal1 A G 4: 56,837,848 (GRCm39) F261L probably damaging Het
Defb22 A T 2: 152,327,950 (GRCm39) N78K unknown Het
Dele1 T A 18: 38,392,978 (GRCm39) I394N probably damaging Het
Efr3a G A 15: 65,709,283 (GRCm39) probably null Het
Elp4 G T 2: 105,734,826 (GRCm39) A3E probably damaging Het
Emilin2 A G 17: 71,580,905 (GRCm39) V607A probably benign Het
Epsti1 A G 14: 78,141,930 (GRCm39) Y2C probably damaging Het
Fam81b A C 13: 76,419,412 (GRCm39) L46R probably damaging Het
Fam81b G T 13: 76,419,413 (GRCm39) L46I possibly damaging Het
Fbxo15 T A 18: 84,982,278 (GRCm39) H288Q probably damaging Het
Gabrg1 T A 5: 70,973,323 (GRCm39) N77I probably damaging Het
Ganab A G 19: 8,890,216 (GRCm39) Y715C possibly damaging Het
H2bc27 T C 11: 58,840,102 (GRCm39) S113P possibly damaging Het
Iqgap2 T C 13: 95,764,627 (GRCm39) D1539G probably damaging Het
Kcp T C 6: 29,496,516 (GRCm39) N633S probably benign Het
Krt6a C A 15: 101,598,978 (GRCm39) S529I unknown Het
Leo1 A G 9: 75,352,844 (GRCm39) H129R probably benign Het
Mcm9 A G 10: 53,413,665 (GRCm39) S472P probably benign Het
Med27 T A 2: 29,267,950 (GRCm39) V33D Het
Mgat4f T C 1: 134,317,800 (GRCm39) C191R probably benign Het
Mup15 C T 4: 61,356,526 (GRCm39) E80K probably benign Het
Myo18a G A 11: 77,750,246 (GRCm39) R199H Het
Nebl T A 2: 17,395,727 (GRCm39) R558* probably null Het
Or10ak8 A T 4: 118,774,183 (GRCm39) H160Q probably benign Het
Or11g7 G T 14: 50,691,342 (GRCm39) V278L probably benign Het
Or12e9 A G 2: 87,202,613 (GRCm39) T246A probably damaging Het
Or4a79 A T 2: 89,551,603 (GRCm39) I284K probably damaging Het
Or5p78 T C 7: 108,212,198 (GRCm39) I228T probably damaging Het
Or6c217 T C 10: 129,738,222 (GRCm39) D119G probably damaging Het
Or8b41 A T 9: 38,054,736 (GRCm39) M97L probably benign Het
Pde11a A T 2: 76,045,697 (GRCm39) F376I possibly damaging Het
Prima1 A T 12: 103,201,920 (GRCm39) C52S probably damaging Het
Pxn G A 5: 115,686,606 (GRCm39) R366H not run Het
Sgce T C 6: 4,691,564 (GRCm39) Y337C probably damaging Het
Slc25a10 T A 11: 120,386,286 (GRCm39) M130K probably benign Het
Slc29a2 A T 19: 5,074,290 (GRCm39) N5I probably benign Het
Slc35a1 A T 4: 34,673,875 (GRCm39) H150Q Het
Slc5a4a T A 10: 75,983,384 (GRCm39) V7D unknown Het
Stk17b T A 1: 53,805,159 (GRCm39) D134V probably damaging Het
Tex55 C T 16: 38,648,453 (GRCm39) D219N possibly damaging Het
Thbs3 T A 3: 89,124,014 (GRCm39) S36T probably benign Het
Thsd4 A G 9: 60,335,457 (GRCm39) S152P probably benign Het
Tmem67 G T 4: 12,063,698 (GRCm39) H422N probably benign Het
Tram1 C A 1: 13,659,868 (GRCm39) V27F probably damaging Het
Trim14 A G 4: 46,507,238 (GRCm39) V326A possibly damaging Het
Other mutations in Lmf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03153:Lmf1 APN 17 25,804,624 (GRCm39) missense possibly damaging 0.51
R0117:Lmf1 UTSW 17 25,874,965 (GRCm39) unclassified probably benign
R1757:Lmf1 UTSW 17 25,874,184 (GRCm39) missense probably damaging 1.00
R1906:Lmf1 UTSW 17 25,831,309 (GRCm39) missense probably damaging 0.99
R2389:Lmf1 UTSW 17 25,873,445 (GRCm39) missense probably damaging 1.00
R2446:Lmf1 UTSW 17 25,873,445 (GRCm39) missense probably damaging 1.00
R3797:Lmf1 UTSW 17 25,873,445 (GRCm39) missense probably damaging 1.00
R3798:Lmf1 UTSW 17 25,873,445 (GRCm39) missense probably damaging 1.00
R3855:Lmf1 UTSW 17 25,873,445 (GRCm39) missense probably damaging 1.00
R3953:Lmf1 UTSW 17 25,873,445 (GRCm39) missense probably damaging 1.00
R3955:Lmf1 UTSW 17 25,873,445 (GRCm39) missense probably damaging 1.00
R3956:Lmf1 UTSW 17 25,873,445 (GRCm39) missense probably damaging 1.00
R4290:Lmf1 UTSW 17 25,873,455 (GRCm39) missense probably damaging 1.00
R4291:Lmf1 UTSW 17 25,873,455 (GRCm39) missense probably damaging 1.00
R4293:Lmf1 UTSW 17 25,873,455 (GRCm39) missense probably damaging 1.00
R4636:Lmf1 UTSW 17 25,873,445 (GRCm39) missense probably damaging 1.00
R4698:Lmf1 UTSW 17 25,798,324 (GRCm39) missense probably damaging 0.98
R4791:Lmf1 UTSW 17 25,873,445 (GRCm39) missense probably damaging 1.00
R4792:Lmf1 UTSW 17 25,873,445 (GRCm39) missense probably damaging 1.00
R4968:Lmf1 UTSW 17 25,804,592 (GRCm39) missense probably damaging 1.00
R4997:Lmf1 UTSW 17 25,807,650 (GRCm39) nonsense probably null
R5047:Lmf1 UTSW 17 25,850,812 (GRCm39) intron probably benign
R5152:Lmf1 UTSW 17 25,874,493 (GRCm39) missense probably damaging 0.99
R5419:Lmf1 UTSW 17 25,881,610 (GRCm39) missense possibly damaging 0.94
R6162:Lmf1 UTSW 17 25,831,368 (GRCm39) missense probably benign 0.00
R6693:Lmf1 UTSW 17 25,864,252 (GRCm39) missense probably benign 0.00
R7583:Lmf1 UTSW 17 25,874,423 (GRCm39) missense
R7642:Lmf1 UTSW 17 25,873,445 (GRCm39) missense probably damaging 1.00
R7667:Lmf1 UTSW 17 25,873,582 (GRCm39) critical splice donor site probably null
R7818:Lmf1 UTSW 17 25,881,565 (GRCm39) missense probably benign 0.30
R8851:Lmf1 UTSW 17 25,804,680 (GRCm39) nonsense probably null
R9181:Lmf1 UTSW 17 25,804,718 (GRCm39) missense probably damaging 0.99
R9524:Lmf1 UTSW 17 25,881,514 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATACTGAAGCCACCACGGAG -3'
(R):5'- CATAAAGTTTAAGCAGCCACTGAG -3'

Sequencing Primer
(F):5'- AAGAGGTCCGCGTGTCATC -3'
(R):5'- GTGAGAAGGCGGGGTCC -3'
Posted On 2019-11-12