Incidental Mutation 'R7671:Emilin2'
ID592187
Institutional Source Beutler Lab
Gene Symbol Emilin2
Ensembl Gene ENSMUSG00000024053
Gene Nameelastin microfibril interfacer 2
SynonymsFOAP-10, basilin
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R7671 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location71252176-71310965 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71273910 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 607 (V607A)
Ref Sequence ENSEMBL: ENSMUSP00000024849 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024849]
Predicted Effect probably benign
Transcript: ENSMUST00000024849
AA Change: V607A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000024849
Gene: ENSMUSG00000024053
AA Change: V607A

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:EMI 48 118 1.2e-18 PFAM
coiled coil region 181 216 N/A INTRINSIC
coiled coil region 259 308 N/A INTRINSIC
coiled coil region 590 618 N/A INTRINSIC
low complexity region 809 826 N/A INTRINSIC
low complexity region 833 848 N/A INTRINSIC
low complexity region 914 927 N/A INTRINSIC
Pfam:C1q 928 1067 5.1e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit disruptions in platelet activation, thrombus formation and clot retraction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T A 18: 38,259,925 I394N probably damaging Het
4930435E12Rik C T 16: 38,828,091 D219N possibly damaging Het
4932438A13Rik T C 3: 36,943,231 F1146L probably damaging Het
4933406M09Rik T C 1: 134,390,062 C191R probably benign Het
Akap13 C A 7: 75,569,900 T17K probably damaging Het
Ankrd29 T A 18: 12,260,986 K257I probably damaging Het
Bicc1 A G 10: 70,957,167 L219P probably benign Het
Boc C T 16: 44,491,849 V617M Het
Ccl8 A G 11: 82,115,207 probably benign Het
Col18a1 A G 10: 77,085,383 L261P unknown Het
Col5a3 T A 9: 20,775,086 probably null Het
Cryba4 A C 5: 112,248,173 probably null Het
Csf2rb A G 15: 78,338,930 Y114C probably damaging Het
Ctif T C 18: 75,472,016 D484G probably damaging Het
Ctnnal1 A G 4: 56,837,848 F261L probably damaging Het
Defb22 A T 2: 152,486,030 N78K unknown Het
Efr3a G A 15: 65,837,434 probably null Het
Elp4 G T 2: 105,904,481 A3E probably damaging Het
Epsti1 A G 14: 77,904,490 Y2C probably damaging Het
Fam81b A C 13: 76,271,293 L46R probably damaging Het
Fam81b G T 13: 76,271,294 L46I possibly damaging Het
Fbxo15 T A 18: 84,964,153 H288Q probably damaging Het
Gabrg1 T A 5: 70,815,980 N77I probably damaging Het
Ganab A G 19: 8,912,852 Y715C possibly damaging Het
Hist3h2ba T C 11: 58,949,276 S113P possibly damaging Het
Iqgap2 T C 13: 95,628,119 D1539G probably damaging Het
Kcp T C 6: 29,496,517 N633S probably benign Het
Krt6a C A 15: 101,690,543 S529I unknown Het
Leo1 A G 9: 75,445,562 H129R probably benign Het
Lmf1 G A 17: 25,579,349 V55M possibly damaging Het
Mcm9 A G 10: 53,537,569 S472P probably benign Het
Med27 T A 2: 29,377,938 V33D Het
Mup15 C T 4: 61,438,289 E80K probably benign Het
Myo18a G A 11: 77,859,420 R199H Het
Nebl T A 2: 17,390,916 R558* probably null Het
Olfr1121 A G 2: 87,372,269 T246A probably damaging Het
Olfr1252 A T 2: 89,721,259 I284K probably damaging Het
Olfr1329 A T 4: 118,916,986 H160Q probably benign Het
Olfr506 T C 7: 108,612,991 I228T probably damaging Het
Olfr740 G T 14: 50,453,885 V278L probably benign Het
Olfr815 T C 10: 129,902,353 D119G probably damaging Het
Olfr890 A T 9: 38,143,440 M97L probably benign Het
Pde11a A T 2: 76,215,353 F376I possibly damaging Het
Prima1 A T 12: 103,235,661 C52S probably damaging Het
Pxn G A 5: 115,548,547 R366H not run Het
Sgce T C 6: 4,691,564 Y337C probably damaging Het
Slc25a10 T A 11: 120,495,460 M130K probably benign Het
Slc29a2 A T 19: 5,024,262 N5I probably benign Het
Slc35a1 A T 4: 34,673,875 H150Q Het
Slc5a4a T A 10: 76,147,550 V7D unknown Het
Stk17b T A 1: 53,766,000 D134V probably damaging Het
Thbs3 T A 3: 89,216,707 S36T probably benign Het
Thsd4 A G 9: 60,428,174 S152P probably benign Het
Tmem67 G T 4: 12,063,698 H422N probably benign Het
Tram1 C A 1: 13,589,644 V27F probably damaging Het
Trim14 A G 4: 46,507,238 V326A possibly damaging Het
Other mutations in Emilin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Emilin2 APN 17 71252859 missense possibly damaging 0.80
IGL01294:Emilin2 APN 17 71274594 missense probably benign 0.07
IGL02085:Emilin2 APN 17 71275149 missense probably damaging 0.99
IGL02433:Emilin2 APN 17 71274129 missense probably benign
IGL02587:Emilin2 APN 17 71280856 splice site probably benign
IGL02639:Emilin2 APN 17 71274549 missense probably benign 0.00
IGL02798:Emilin2 APN 17 71256695 splice site probably benign
IGL02952:Emilin2 APN 17 71280821 missense probably damaging 0.99
IGL02954:Emilin2 APN 17 71256531 missense probably benign 0.37
PIT4431001:Emilin2 UTSW 17 71255995 missense probably benign 0.16
PIT4802001:Emilin2 UTSW 17 71273469 missense probably damaging 1.00
R0011:Emilin2 UTSW 17 71273868 missense probably benign 0.01
R0033:Emilin2 UTSW 17 71275014 missense probably benign 0.27
R0784:Emilin2 UTSW 17 71275287 missense possibly damaging 0.83
R0830:Emilin2 UTSW 17 71273820 missense probably benign
R1301:Emilin2 UTSW 17 71255965 splice site probably benign
R1394:Emilin2 UTSW 17 71253071 missense possibly damaging 0.79
R1501:Emilin2 UTSW 17 71310761 missense probably benign
R1576:Emilin2 UTSW 17 71255117 critical splice donor site probably null
R1676:Emilin2 UTSW 17 71274090 missense probably benign 0.14
R2063:Emilin2 UTSW 17 71274955 missense probably benign
R2149:Emilin2 UTSW 17 71273992 missense probably benign 0.06
R2238:Emilin2 UTSW 17 71274739 missense possibly damaging 0.83
R2239:Emilin2 UTSW 17 71310224 missense probably benign 0.00
R2380:Emilin2 UTSW 17 71310224 missense probably benign 0.00
R2420:Emilin2 UTSW 17 71274279 missense possibly damaging 0.90
R3721:Emilin2 UTSW 17 71273454 missense probably benign 0.12
R4176:Emilin2 UTSW 17 71274263 missense probably benign 0.00
R4348:Emilin2 UTSW 17 71280731 missense probably benign
R4352:Emilin2 UTSW 17 71280731 missense probably benign
R4695:Emilin2 UTSW 17 71252778 missense probably damaging 1.00
R4807:Emilin2 UTSW 17 71273448 missense probably damaging 0.98
R4980:Emilin2 UTSW 17 71253071 missense possibly damaging 0.79
R5028:Emilin2 UTSW 17 71274732 missense possibly damaging 0.91
R5048:Emilin2 UTSW 17 71273967 missense probably damaging 1.00
R5153:Emilin2 UTSW 17 71273502 missense possibly damaging 0.83
R5519:Emilin2 UTSW 17 71252935 missense probably benign 0.12
R5580:Emilin2 UTSW 17 71275230 missense probably benign
R6088:Emilin2 UTSW 17 71255124 missense probably benign
R6248:Emilin2 UTSW 17 71274117 missense probably benign 0.04
R6429:Emilin2 UTSW 17 71310956 start gained probably benign
R7085:Emilin2 UTSW 17 71274105 missense probably damaging 1.00
R7260:Emilin2 UTSW 17 71274790 missense probably benign 0.00
R7525:Emilin2 UTSW 17 71274979 missense probably benign
R7895:Emilin2 UTSW 17 71273913 missense probably benign 0.03
R8257:Emilin2 UTSW 17 71274000 missense probably benign
R8310:Emilin2 UTSW 17 71255146 missense probably damaging 1.00
R8311:Emilin2 UTSW 17 71255146 missense probably damaging 1.00
X0064:Emilin2 UTSW 17 71280703 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTCTAGCTCAGCCAACATTTG -3'
(R):5'- AAGTGGTTGAGGACTTCTGCC -3'

Sequencing Primer
(F):5'- AACATTTGGTTCTGCAGCTTCTG -3'
(R):5'- TGAGGACTTCTGCCTGCAG -3'
Posted On2019-11-12