Mutagenetix > Incidental Mutations

Incidental Mutation 'R7671:Slc29a2'

592192

Institutional Source

Beutler Lab

Gene Symbol

Slc29a2

Ensembl Gene

ENSMUSG00000024891

Gene Name

solute carrier family 29 (nucleoside transporters), member 2

Synonyms

HNP36, ENT2, Der12

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.357) question?

Stock #

R7671 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

5024006-5031971 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 5024262 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 5 (N5I)

Ref Sequence

ENSEMBL: ENSMUSP00000025826 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025826]

Predicted Effect

probably benign
Transcript: ENSMUST00000025826
AA Change: N5I

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000025826
Gene: ENSMUSG00000024891
AA Change: N5I

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
transmembrane domain	67	89	N/A	INTRINSIC
transmembrane domain	96	115	N/A	INTRINSIC
Pfam:Nucleoside_tran	130	454	3.7e-117	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The uptake of nucleosides by transporters, such as SLC29A2, is essential for nucleotide synthesis by salvage pathways in cells that lack de novo biosynthetic pathways. Nucleoside transport also plays a key role in the regulation of many physiologic processes through its effect on adenosine concentration at the cell surface (Griffiths et al., 1997 [PubMed 9396714]).[supplied by OMIM, Nov 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit normal adenosine uptake in erythrocytes and protection from acute lung injury. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	T	A	18: 38,259,925	I394N	probably damaging	Het
4930435E12Rik	C	T	16: 38,828,091	D219N	possibly damaging	Het
4932438A13Rik	T	C	3: 36,943,231	F1146L	probably damaging	Het
4933406M09Rik	T	C	1: 134,390,062	C191R	probably benign	Het
Akap13	C	A	7: 75,569,900	T17K	probably damaging	Het
Ankrd29	T	A	18: 12,260,986	K257I	probably damaging	Het
Bicc1	A	G	10: 70,957,167	L219P	probably benign	Het
Boc	C	T	16: 44,491,849	V617M		Het
Ccl8	A	G	11: 82,115,207		probably benign	Het
Col18a1	A	G	10: 77,085,383	L261P	unknown	Het
Col5a3	T	A	9: 20,775,086		probably null	Het
Cryba4	A	C	5: 112,248,173		probably null	Het
Csf2rb	A	G	15: 78,338,930	Y114C	probably damaging	Het
Ctif	T	C	18: 75,472,016	D484G	probably damaging	Het
Ctnnal1	A	G	4: 56,837,848	F261L	probably damaging	Het
Defb22	A	T	2: 152,486,030	N78K	unknown	Het
Efr3a	G	A	15: 65,837,434		probably null	Het
Elp4	G	T	2: 105,904,481	A3E	probably damaging	Het
Emilin2	A	G	17: 71,273,910	V607A	probably benign	Het
Epsti1	A	G	14: 77,904,490	Y2C	probably damaging	Het
Fam81b	A	C	13: 76,271,293	L46R	probably damaging	Het
Fam81b	G	T	13: 76,271,294	L46I	possibly damaging	Het
Fbxo15	T	A	18: 84,964,153	H288Q	probably damaging	Het
Gabrg1	T	A	5: 70,815,980	N77I	probably damaging	Het
Ganab	A	G	19: 8,912,852	Y715C	possibly damaging	Het
Hist3h2ba	T	C	11: 58,949,276	S113P	possibly damaging	Het
Iqgap2	T	C	13: 95,628,119	D1539G	probably damaging	Het
Kcp	T	C	6: 29,496,517	N633S	probably benign	Het
Krt6a	C	A	15: 101,690,543	S529I	unknown	Het
Leo1	A	G	9: 75,445,562	H129R	probably benign	Het
Lmf1	G	A	17: 25,579,349	V55M	possibly damaging	Het
Mcm9	A	G	10: 53,537,569	S472P	probably benign	Het
Med27	T	A	2: 29,377,938	V33D		Het
Mup15	C	T	4: 61,438,289	E80K	probably benign	Het
Myo18a	G	A	11: 77,859,420	R199H		Het
Nebl	T	A	2: 17,390,916	R558*	probably null	Het
Olfr1121	A	G	2: 87,372,269	T246A	probably damaging	Het
Olfr1252	A	T	2: 89,721,259	I284K	probably damaging	Het
Olfr1329	A	T	4: 118,916,986	H160Q	probably benign	Het
Olfr506	T	C	7: 108,612,991	I228T	probably damaging	Het
Olfr740	G	T	14: 50,453,885	V278L	probably benign	Het
Olfr815	T	C	10: 129,902,353	D119G	probably damaging	Het
Olfr890	A	T	9: 38,143,440	M97L	probably benign	Het
Pde11a	A	T	2: 76,215,353	F376I	possibly damaging	Het
Prima1	A	T	12: 103,235,661	C52S	probably damaging	Het
Pxn	G	A	5: 115,548,547	R366H	not run	Het
Sgce	T	C	6: 4,691,564	Y337C	probably damaging	Het
Slc25a10	T	A	11: 120,495,460	M130K	probably benign	Het
Slc35a1	A	T	4: 34,673,875	H150Q		Het
Slc5a4a	T	A	10: 76,147,550	V7D	unknown	Het
Stk17b	T	A	1: 53,766,000	D134V	probably damaging	Het
Thbs3	T	A	3: 89,216,707	S36T	probably benign	Het
Thsd4	A	G	9: 60,428,174	S152P	probably benign	Het
Tmem67	G	T	4: 12,063,698	H422N	probably benign	Het
Tram1	C	A	1: 13,589,644	V27F	probably damaging	Het
Trim14	A	G	4: 46,507,238	V326A	possibly damaging	Het

Other mutations in Slc29a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01606:Slc29a2	APN	19	5027439	missense	possibly damaging	0.72
IGL01727:Slc29a2	APN	19	5026458	missense	probably damaging	0.98
IGL03268:Slc29a2	APN	19	5024503	splice site	probably benign
R4050:Slc29a2	UTSW	19	5029453	missense	possibly damaging	0.92
R4615:Slc29a2	UTSW	19	5029264	missense	probably damaging	0.98
R5186:Slc29a2	UTSW	19	5028967	missense	probably benign	0.00
R5450:Slc29a2	UTSW	19	5029275	missense	probably benign	0.24
R5512:Slc29a2	UTSW	19	5026398	missense	probably benign	0.03
R6461:Slc29a2	UTSW	19	5027740	missense	probably benign	0.03
R6809:Slc29a2	UTSW	19	5029243	missense	probably damaging	1.00
R7447:Slc29a2	UTSW	19	5026417	missense	probably damaging	1.00
R8427:Slc29a2	UTSW	19	5030420	missense	probably benign	0.22

Predicted Primers

PCR Primer
(F):5'- AACGTGGTCCGCAGTGTAAC -3'
(R):5'- GGATCAATCAGAAGGTCACCCC -3'

Sequencing Primer
(F):5'- TGGTCCGCAGTGTAACCCAAC -3'
(R):5'- GCCCCTCAGTAGAACGGAC -3'

Posted On

2019-11-12