Mutagenetix > Incidental Mutations

Incidental Mutation 'R7671:Ganab'

592193

Institutional Source

Beutler Lab

Gene Symbol

Ganab

Ensembl Gene

ENSMUSG00000071650

Gene Name

alpha glucosidase 2 alpha neutral subunit

Synonyms

G2an, GluII

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.906) question?

Stock #

R7671 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

8898090-8916663 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 8912852 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 715 (Y715C)

Ref Sequence

ENSEMBL: ENSMUSP00000093965 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096246]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000096246
AA Change: Y715C

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000093965
Gene: ENSMUSG00000071650
AA Change: Y715C

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
low complexity region	157	169	N/A	INTRINSIC
Pfam:Gal_mutarotas_2	275	346	3.9e-24	PFAM
Pfam:Glyco_hydro_31	387	832	8.7e-136	PFAM
low complexity region	888	898	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha subunit of glucosidase II and a member of the glycosyl hydrolase 31 family of proteins. The heterodimeric enzyme glucosidase II plays a role in protein folding and quality control by cleaving glucose residues from immature glycoproteins in the endoplasmic reticulum. Expression of the encoded protein is elevated in lung tumor tissue and in response to UV irradiation. Mutations in this gene cause autosomal-dominant polycystic kidney and liver disease. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	T	A	18: 38,259,925	I394N	probably damaging	Het
4930435E12Rik	C	T	16: 38,828,091	D219N	possibly damaging	Het
4932438A13Rik	T	C	3: 36,943,231	F1146L	probably damaging	Het
4933406M09Rik	T	C	1: 134,390,062	C191R	probably benign	Het
Akap13	C	A	7: 75,569,900	T17K	probably damaging	Het
Ankrd29	T	A	18: 12,260,986	K257I	probably damaging	Het
Bicc1	A	G	10: 70,957,167	L219P	probably benign	Het
Boc	C	T	16: 44,491,849	V617M		Het
Ccl8	A	G	11: 82,115,207		probably benign	Het
Col18a1	A	G	10: 77,085,383	L261P	unknown	Het
Col5a3	T	A	9: 20,775,086		probably null	Het
Cryba4	A	C	5: 112,248,173		probably null	Het
Csf2rb	A	G	15: 78,338,930	Y114C	probably damaging	Het
Ctif	T	C	18: 75,472,016	D484G	probably damaging	Het
Ctnnal1	A	G	4: 56,837,848	F261L	probably damaging	Het
Defb22	A	T	2: 152,486,030	N78K	unknown	Het
Efr3a	G	A	15: 65,837,434		probably null	Het
Elp4	G	T	2: 105,904,481	A3E	probably damaging	Het
Emilin2	A	G	17: 71,273,910	V607A	probably benign	Het
Epsti1	A	G	14: 77,904,490	Y2C	probably damaging	Het
Fam81b	A	C	13: 76,271,293	L46R	probably damaging	Het
Fam81b	G	T	13: 76,271,294	L46I	possibly damaging	Het
Fbxo15	T	A	18: 84,964,153	H288Q	probably damaging	Het
Gabrg1	T	A	5: 70,815,980	N77I	probably damaging	Het
Hist3h2ba	T	C	11: 58,949,276	S113P	possibly damaging	Het
Iqgap2	T	C	13: 95,628,119	D1539G	probably damaging	Het
Kcp	T	C	6: 29,496,517	N633S	probably benign	Het
Krt6a	C	A	15: 101,690,543	S529I	unknown	Het
Leo1	A	G	9: 75,445,562	H129R	probably benign	Het
Lmf1	G	A	17: 25,579,349	V55M	possibly damaging	Het
Mcm9	A	G	10: 53,537,569	S472P	probably benign	Het
Med27	T	A	2: 29,377,938	V33D		Het
Mup15	C	T	4: 61,438,289	E80K	probably benign	Het
Myo18a	G	A	11: 77,859,420	R199H		Het
Nebl	T	A	2: 17,390,916	R558*	probably null	Het
Olfr1121	A	G	2: 87,372,269	T246A	probably damaging	Het
Olfr1252	A	T	2: 89,721,259	I284K	probably damaging	Het
Olfr1329	A	T	4: 118,916,986	H160Q	probably benign	Het
Olfr506	T	C	7: 108,612,991	I228T	probably damaging	Het
Olfr740	G	T	14: 50,453,885	V278L	probably benign	Het
Olfr815	T	C	10: 129,902,353	D119G	probably damaging	Het
Olfr890	A	T	9: 38,143,440	M97L	probably benign	Het
Pde11a	A	T	2: 76,215,353	F376I	possibly damaging	Het
Prima1	A	T	12: 103,235,661	C52S	probably damaging	Het
Pxn	G	A	5: 115,548,547	R366H	not run	Het
Sgce	T	C	6: 4,691,564	Y337C	probably damaging	Het
Slc25a10	T	A	11: 120,495,460	M130K	probably benign	Het
Slc29a2	A	T	19: 5,024,262	N5I	probably benign	Het
Slc35a1	A	T	4: 34,673,875	H150Q		Het
Slc5a4a	T	A	10: 76,147,550	V7D	unknown	Het
Stk17b	T	A	1: 53,766,000	D134V	probably damaging	Het
Thbs3	T	A	3: 89,216,707	S36T	probably benign	Het
Thsd4	A	G	9: 60,428,174	S152P	probably benign	Het
Tmem67	G	T	4: 12,063,698	H422N	probably benign	Het
Tram1	C	A	1: 13,589,644	V27F	probably damaging	Het
Trim14	A	G	4: 46,507,238	V326A	possibly damaging	Het

Other mutations in Ganab

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00158:Ganab	APN	19	8902595	missense	probably benign
IGL00434:Ganab	APN	19	8907343	missense	probably damaging	1.00
IGL01415:Ganab	APN	19	8914694	splice site	probably benign
IGL02418:Ganab	APN	19	8911069	missense	probably null	0.97
IGL02886:Ganab	APN	19	8911027	splice site	probably benign
IGL02997:Ganab	APN	19	8915412	missense	probably benign	0.00
IGL03108:Ganab	APN	19	8912476	missense	probably damaging	1.00
R0240:Ganab	UTSW	19	8912813	missense	possibly damaging	0.58
R0240:Ganab	UTSW	19	8912813	missense	possibly damaging	0.58
R0349:Ganab	UTSW	19	8911652	missense	probably null	0.11
R0457:Ganab	UTSW	19	8907250	missense	possibly damaging	0.92
R0551:Ganab	UTSW	19	8907280	missense	probably benign	0.35
R0645:Ganab	UTSW	19	8911113	missense	probably damaging	1.00
R0652:Ganab	UTSW	19	8915402	critical splice acceptor site	probably null
R0688:Ganab	UTSW	19	8911113	missense	probably damaging	1.00
R0726:Ganab	UTSW	19	8911113	missense	probably damaging	1.00
R1427:Ganab	UTSW	19	8915666	missense	probably benign	0.00
R1946:Ganab	UTSW	19	8910808	missense	probably damaging	1.00
R1955:Ganab	UTSW	19	8911616	nonsense	probably null
R2173:Ganab	UTSW	19	8902260	unclassified	probably benign
R2280:Ganab	UTSW	19	8909468	missense	probably damaging	1.00
R2281:Ganab	UTSW	19	8909468	missense	probably damaging	1.00
R4897:Ganab	UTSW	19	8914991	missense	probably benign	0.07
R5224:Ganab	UTSW	19	8910591	missense	probably benign	0.35
R5269:Ganab	UTSW	19	8911937	missense	probably damaging	1.00
R5323:Ganab	UTSW	19	8908685	missense	probably benign	0.00
R5850:Ganab	UTSW	19	8911707	missense	probably damaging	1.00
R6469:Ganab	UTSW	19	8902632	critical splice donor site	probably null
R6911:Ganab	UTSW	19	8907788	splice site	probably null
R7284:Ganab	UTSW	19	8912540	missense	probably damaging	1.00
R7412:Ganab	UTSW	19	8912528	missense	probably benign	0.01
R7413:Ganab	UTSW	19	8904975	missense	probably benign	0.01
R7466:Ganab	UTSW	19	8914569	nonsense	probably null
R7586:Ganab	UTSW	19	8911352	missense	possibly damaging	0.76
R7657:Ganab	UTSW	19	8907357	missense	probably damaging	0.99
R7729:Ganab	UTSW	19	8914712	missense	probably benign	0.24
R8223:Ganab	UTSW	19	8910828	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAAAGGACCTGGGCATGAAC -3'
(R):5'- GAGATGCAAACCAGACCTCATTATC -3'

Sequencing Primer
(F):5'- TATATGAATGGCTGCCAGCGC -3'
(R):5'- AGACCTCATTATCTCCCAGTCATC -3'

Posted On

2019-11-12