Incidental Mutation 'R7671:Ganab'
ID592193
Institutional Source Beutler Lab
Gene Symbol Ganab
Ensembl Gene ENSMUSG00000071650
Gene Namealpha glucosidase 2 alpha neutral subunit
SynonymsG2an, GluII
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.867) question?
Stock #R7671 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location8898090-8916663 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8912852 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 715 (Y715C)
Ref Sequence ENSEMBL: ENSMUSP00000093965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096246]
Predicted Effect possibly damaging
Transcript: ENSMUST00000096246
AA Change: Y715C

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000093965
Gene: ENSMUSG00000071650
AA Change: Y715C

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
low complexity region 157 169 N/A INTRINSIC
Pfam:Gal_mutarotas_2 275 346 3.9e-24 PFAM
Pfam:Glyco_hydro_31 387 832 8.7e-136 PFAM
low complexity region 888 898 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha subunit of glucosidase II and a member of the glycosyl hydrolase 31 family of proteins. The heterodimeric enzyme glucosidase II plays a role in protein folding and quality control by cleaving glucose residues from immature glycoproteins in the endoplasmic reticulum. Expression of the encoded protein is elevated in lung tumor tissue and in response to UV irradiation. Mutations in this gene cause autosomal-dominant polycystic kidney and liver disease. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T A 18: 38,259,925 I394N probably damaging Het
4930435E12Rik C T 16: 38,828,091 D219N possibly damaging Het
4932438A13Rik T C 3: 36,943,231 F1146L probably damaging Het
4933406M09Rik T C 1: 134,390,062 C191R probably benign Het
Akap13 C A 7: 75,569,900 T17K probably damaging Het
Ankrd29 T A 18: 12,260,986 K257I probably damaging Het
Bicc1 A G 10: 70,957,167 L219P probably benign Het
Boc C T 16: 44,491,849 V617M Het
Ccl8 A G 11: 82,115,207 probably benign Het
Col18a1 A G 10: 77,085,383 L261P unknown Het
Col5a3 T A 9: 20,775,086 probably null Het
Cryba4 A C 5: 112,248,173 probably null Het
Csf2rb A G 15: 78,338,930 Y114C probably damaging Het
Ctif T C 18: 75,472,016 D484G probably damaging Het
Ctnnal1 A G 4: 56,837,848 F261L probably damaging Het
Defb22 A T 2: 152,486,030 N78K unknown Het
Efr3a G A 15: 65,837,434 probably null Het
Elp4 G T 2: 105,904,481 A3E probably damaging Het
Emilin2 A G 17: 71,273,910 V607A probably benign Het
Epsti1 A G 14: 77,904,490 Y2C probably damaging Het
Fam81b A C 13: 76,271,293 L46R probably damaging Het
Fam81b G T 13: 76,271,294 L46I possibly damaging Het
Fbxo15 T A 18: 84,964,153 H288Q probably damaging Het
Gabrg1 T A 5: 70,815,980 N77I probably damaging Het
Hist3h2ba T C 11: 58,949,276 S113P possibly damaging Het
Iqgap2 T C 13: 95,628,119 D1539G probably damaging Het
Kcp T C 6: 29,496,517 N633S probably benign Het
Krt6a C A 15: 101,690,543 S529I unknown Het
Leo1 A G 9: 75,445,562 H129R probably benign Het
Lmf1 G A 17: 25,579,349 V55M possibly damaging Het
Mcm9 A G 10: 53,537,569 S472P probably benign Het
Med27 T A 2: 29,377,938 V33D Het
Mup15 C T 4: 61,438,289 E80K probably benign Het
Myo18a G A 11: 77,859,420 R199H Het
Nebl T A 2: 17,390,916 R558* probably null Het
Olfr1121 A G 2: 87,372,269 T246A probably damaging Het
Olfr1252 A T 2: 89,721,259 I284K probably damaging Het
Olfr1329 A T 4: 118,916,986 H160Q probably benign Het
Olfr506 T C 7: 108,612,991 I228T probably damaging Het
Olfr740 G T 14: 50,453,885 V278L probably benign Het
Olfr815 T C 10: 129,902,353 D119G probably damaging Het
Olfr890 A T 9: 38,143,440 M97L probably benign Het
Pde11a A T 2: 76,215,353 F376I possibly damaging Het
Prima1 A T 12: 103,235,661 C52S probably damaging Het
Pxn G A 5: 115,548,547 R366H not run Het
Sgce T C 6: 4,691,564 Y337C probably damaging Het
Slc25a10 T A 11: 120,495,460 M130K probably benign Het
Slc29a2 A T 19: 5,024,262 N5I probably benign Het
Slc35a1 A T 4: 34,673,875 H150Q Het
Slc5a4a T A 10: 76,147,550 V7D unknown Het
Stk17b T A 1: 53,766,000 D134V probably damaging Het
Thbs3 T A 3: 89,216,707 S36T probably benign Het
Thsd4 A G 9: 60,428,174 S152P probably benign Het
Tmem67 G T 4: 12,063,698 H422N probably benign Het
Tram1 C A 1: 13,589,644 V27F probably damaging Het
Trim14 A G 4: 46,507,238 V326A possibly damaging Het
Other mutations in Ganab
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Ganab APN 19 8902595 missense probably benign
IGL00434:Ganab APN 19 8907343 missense probably damaging 1.00
IGL01415:Ganab APN 19 8914694 splice site probably benign
IGL02418:Ganab APN 19 8911069 missense probably null 0.97
IGL02886:Ganab APN 19 8911027 splice site probably benign
IGL02997:Ganab APN 19 8915412 missense probably benign 0.00
IGL03108:Ganab APN 19 8912476 missense probably damaging 1.00
R0240:Ganab UTSW 19 8912813 missense possibly damaging 0.58
R0240:Ganab UTSW 19 8912813 missense possibly damaging 0.58
R0349:Ganab UTSW 19 8911652 missense probably null 0.11
R0457:Ganab UTSW 19 8907250 missense possibly damaging 0.92
R0551:Ganab UTSW 19 8907280 missense probably benign 0.35
R0645:Ganab UTSW 19 8911113 missense probably damaging 1.00
R0652:Ganab UTSW 19 8915402 critical splice acceptor site probably null
R0688:Ganab UTSW 19 8911113 missense probably damaging 1.00
R0726:Ganab UTSW 19 8911113 missense probably damaging 1.00
R1427:Ganab UTSW 19 8915666 missense probably benign 0.00
R1946:Ganab UTSW 19 8910808 missense probably damaging 1.00
R1955:Ganab UTSW 19 8911616 nonsense probably null
R2173:Ganab UTSW 19 8902260 unclassified probably benign
R2280:Ganab UTSW 19 8909468 missense probably damaging 1.00
R2281:Ganab UTSW 19 8909468 missense probably damaging 1.00
R4897:Ganab UTSW 19 8914991 missense probably benign 0.07
R5224:Ganab UTSW 19 8910591 missense probably benign 0.35
R5269:Ganab UTSW 19 8911937 missense probably damaging 1.00
R5323:Ganab UTSW 19 8908685 missense probably benign 0.00
R5850:Ganab UTSW 19 8911707 missense probably damaging 1.00
R6469:Ganab UTSW 19 8902632 critical splice donor site probably null
R6911:Ganab UTSW 19 8907788 intron probably null
R7284:Ganab UTSW 19 8912540 missense probably damaging 1.00
R7412:Ganab UTSW 19 8912528 missense probably benign 0.01
R7413:Ganab UTSW 19 8904975 missense probably benign 0.01
R7466:Ganab UTSW 19 8914569 nonsense probably null
R7586:Ganab UTSW 19 8911352 missense possibly damaging 0.76
R7657:Ganab UTSW 19 8907357 missense probably damaging 0.99
R7729:Ganab UTSW 19 8914712 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- CAAAGGACCTGGGCATGAAC -3'
(R):5'- GAGATGCAAACCAGACCTCATTATC -3'

Sequencing Primer
(F):5'- TATATGAATGGCTGCCAGCGC -3'
(R):5'- AGACCTCATTATCTCCCAGTCATC -3'
Posted On2019-11-12