Incidental Mutation 'R7671:Ganab'
ID 592193
Institutional Source Beutler Lab
Gene Symbol Ganab
Ensembl Gene ENSMUSG00000071650
Gene Name alpha glucosidase 2 alpha neutral subunit
Synonyms G2an, GluII
Accession Numbers
Essential gene? Probably essential (E-score: 0.920) question?
Stock # R7671 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 8875435-8894036 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 8890216 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 715 (Y715C)
Ref Sequence ENSEMBL: ENSMUSP00000093965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096246]
AlphaFold Q8BHN3
Predicted Effect possibly damaging
Transcript: ENSMUST00000096246
AA Change: Y715C

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000093965
Gene: ENSMUSG00000071650
AA Change: Y715C

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
low complexity region 157 169 N/A INTRINSIC
Pfam:Gal_mutarotas_2 275 346 3.9e-24 PFAM
Pfam:Glyco_hydro_31 387 832 8.7e-136 PFAM
low complexity region 888 898 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha subunit of glucosidase II and a member of the glycosyl hydrolase 31 family of proteins. The heterodimeric enzyme glucosidase II plays a role in protein folding and quality control by cleaving glucose residues from immature glycoproteins in the endoplasmic reticulum. Expression of the encoded protein is elevated in lung tumor tissue and in response to UV irradiation. Mutations in this gene cause autosomal-dominant polycystic kidney and liver disease. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 C A 7: 75,219,648 (GRCm39) T17K probably damaging Het
Ankrd29 T A 18: 12,394,043 (GRCm39) K257I probably damaging Het
Bicc1 A G 10: 70,792,997 (GRCm39) L219P probably benign Het
Bltp1 T C 3: 36,997,380 (GRCm39) F1146L probably damaging Het
Boc C T 16: 44,312,212 (GRCm39) V617M Het
Ccl8 A G 11: 82,006,033 (GRCm39) probably benign Het
Col18a1 A G 10: 76,921,217 (GRCm39) L261P unknown Het
Col5a3 T A 9: 20,686,382 (GRCm39) probably null Het
Cryba4 A C 5: 112,396,039 (GRCm39) probably null Het
Csf2rb A G 15: 78,223,130 (GRCm39) Y114C probably damaging Het
Ctif T C 18: 75,605,087 (GRCm39) D484G probably damaging Het
Ctnnal1 A G 4: 56,837,848 (GRCm39) F261L probably damaging Het
Defb22 A T 2: 152,327,950 (GRCm39) N78K unknown Het
Dele1 T A 18: 38,392,978 (GRCm39) I394N probably damaging Het
Efr3a G A 15: 65,709,283 (GRCm39) probably null Het
Elp4 G T 2: 105,734,826 (GRCm39) A3E probably damaging Het
Emilin2 A G 17: 71,580,905 (GRCm39) V607A probably benign Het
Epsti1 A G 14: 78,141,930 (GRCm39) Y2C probably damaging Het
Fam81b A C 13: 76,419,412 (GRCm39) L46R probably damaging Het
Fam81b G T 13: 76,419,413 (GRCm39) L46I possibly damaging Het
Fbxo15 T A 18: 84,982,278 (GRCm39) H288Q probably damaging Het
Gabrg1 T A 5: 70,973,323 (GRCm39) N77I probably damaging Het
H2bc27 T C 11: 58,840,102 (GRCm39) S113P possibly damaging Het
Iqgap2 T C 13: 95,764,627 (GRCm39) D1539G probably damaging Het
Kcp T C 6: 29,496,516 (GRCm39) N633S probably benign Het
Krt6a C A 15: 101,598,978 (GRCm39) S529I unknown Het
Leo1 A G 9: 75,352,844 (GRCm39) H129R probably benign Het
Lmf1 G A 17: 25,798,323 (GRCm39) V55M possibly damaging Het
Mcm9 A G 10: 53,413,665 (GRCm39) S472P probably benign Het
Med27 T A 2: 29,267,950 (GRCm39) V33D Het
Mgat4f T C 1: 134,317,800 (GRCm39) C191R probably benign Het
Mup15 C T 4: 61,356,526 (GRCm39) E80K probably benign Het
Myo18a G A 11: 77,750,246 (GRCm39) R199H Het
Nebl T A 2: 17,395,727 (GRCm39) R558* probably null Het
Or10ak8 A T 4: 118,774,183 (GRCm39) H160Q probably benign Het
Or11g7 G T 14: 50,691,342 (GRCm39) V278L probably benign Het
Or12e9 A G 2: 87,202,613 (GRCm39) T246A probably damaging Het
Or4a79 A T 2: 89,551,603 (GRCm39) I284K probably damaging Het
Or5p78 T C 7: 108,212,198 (GRCm39) I228T probably damaging Het
Or6c217 T C 10: 129,738,222 (GRCm39) D119G probably damaging Het
Or8b41 A T 9: 38,054,736 (GRCm39) M97L probably benign Het
Pde11a A T 2: 76,045,697 (GRCm39) F376I possibly damaging Het
Prima1 A T 12: 103,201,920 (GRCm39) C52S probably damaging Het
Pxn G A 5: 115,686,606 (GRCm39) R366H not run Het
Sgce T C 6: 4,691,564 (GRCm39) Y337C probably damaging Het
Slc25a10 T A 11: 120,386,286 (GRCm39) M130K probably benign Het
Slc29a2 A T 19: 5,074,290 (GRCm39) N5I probably benign Het
Slc35a1 A T 4: 34,673,875 (GRCm39) H150Q Het
Slc5a4a T A 10: 75,983,384 (GRCm39) V7D unknown Het
Stk17b T A 1: 53,805,159 (GRCm39) D134V probably damaging Het
Tex55 C T 16: 38,648,453 (GRCm39) D219N possibly damaging Het
Thbs3 T A 3: 89,124,014 (GRCm39) S36T probably benign Het
Thsd4 A G 9: 60,335,457 (GRCm39) S152P probably benign Het
Tmem67 G T 4: 12,063,698 (GRCm39) H422N probably benign Het
Tram1 C A 1: 13,659,868 (GRCm39) V27F probably damaging Het
Trim14 A G 4: 46,507,238 (GRCm39) V326A possibly damaging Het
Other mutations in Ganab
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Ganab APN 19 8,879,959 (GRCm39) missense probably benign
IGL00434:Ganab APN 19 8,884,707 (GRCm39) missense probably damaging 1.00
IGL01415:Ganab APN 19 8,892,058 (GRCm39) splice site probably benign
IGL02418:Ganab APN 19 8,888,433 (GRCm39) missense probably null 0.97
IGL02886:Ganab APN 19 8,888,391 (GRCm39) splice site probably benign
IGL02997:Ganab APN 19 8,892,776 (GRCm39) missense probably benign 0.00
IGL03108:Ganab APN 19 8,889,840 (GRCm39) missense probably damaging 1.00
R0240:Ganab UTSW 19 8,890,177 (GRCm39) missense possibly damaging 0.58
R0240:Ganab UTSW 19 8,890,177 (GRCm39) missense possibly damaging 0.58
R0349:Ganab UTSW 19 8,889,016 (GRCm39) missense probably null 0.11
R0457:Ganab UTSW 19 8,884,614 (GRCm39) missense possibly damaging 0.92
R0551:Ganab UTSW 19 8,884,644 (GRCm39) missense probably benign 0.35
R0645:Ganab UTSW 19 8,888,477 (GRCm39) missense probably damaging 1.00
R0652:Ganab UTSW 19 8,892,766 (GRCm39) critical splice acceptor site probably null
R0688:Ganab UTSW 19 8,888,477 (GRCm39) missense probably damaging 1.00
R0726:Ganab UTSW 19 8,888,477 (GRCm39) missense probably damaging 1.00
R1427:Ganab UTSW 19 8,893,030 (GRCm39) missense probably benign 0.00
R1946:Ganab UTSW 19 8,888,172 (GRCm39) missense probably damaging 1.00
R1955:Ganab UTSW 19 8,888,980 (GRCm39) nonsense probably null
R2173:Ganab UTSW 19 8,879,624 (GRCm39) unclassified probably benign
R2280:Ganab UTSW 19 8,886,832 (GRCm39) missense probably damaging 1.00
R2281:Ganab UTSW 19 8,886,832 (GRCm39) missense probably damaging 1.00
R4897:Ganab UTSW 19 8,892,355 (GRCm39) missense probably benign 0.07
R5224:Ganab UTSW 19 8,887,955 (GRCm39) missense probably benign 0.35
R5269:Ganab UTSW 19 8,889,301 (GRCm39) missense probably damaging 1.00
R5323:Ganab UTSW 19 8,886,049 (GRCm39) missense probably benign 0.00
R5850:Ganab UTSW 19 8,889,071 (GRCm39) missense probably damaging 1.00
R6469:Ganab UTSW 19 8,879,996 (GRCm39) critical splice donor site probably null
R6911:Ganab UTSW 19 8,885,152 (GRCm39) splice site probably null
R7284:Ganab UTSW 19 8,889,904 (GRCm39) missense probably damaging 1.00
R7412:Ganab UTSW 19 8,889,892 (GRCm39) missense probably benign 0.01
R7413:Ganab UTSW 19 8,882,339 (GRCm39) missense probably benign 0.01
R7466:Ganab UTSW 19 8,891,933 (GRCm39) nonsense probably null
R7586:Ganab UTSW 19 8,888,716 (GRCm39) missense possibly damaging 0.76
R7657:Ganab UTSW 19 8,884,721 (GRCm39) missense probably damaging 0.99
R7729:Ganab UTSW 19 8,892,076 (GRCm39) missense probably benign 0.24
R8223:Ganab UTSW 19 8,888,192 (GRCm39) missense probably damaging 1.00
R8873:Ganab UTSW 19 8,888,243 (GRCm39) nonsense probably null
R9264:Ganab UTSW 19 8,890,228 (GRCm39) missense possibly damaging 0.81
R9388:Ganab UTSW 19 8,892,302 (GRCm39) missense probably damaging 1.00
R9447:Ganab UTSW 19 8,886,894 (GRCm39) missense probably damaging 0.99
R9450:Ganab UTSW 19 8,893,076 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAAGGACCTGGGCATGAAC -3'
(R):5'- GAGATGCAAACCAGACCTCATTATC -3'

Sequencing Primer
(F):5'- TATATGAATGGCTGCCAGCGC -3'
(R):5'- AGACCTCATTATCTCCCAGTCATC -3'
Posted On 2019-11-12