Incidental Mutation 'R7672:Cyp26b1'
ID592225
Institutional Source Beutler Lab
Gene Symbol Cyp26b1
Ensembl Gene ENSMUSG00000063415
Gene Namecytochrome P450, family 26, subfamily b, polypeptide 1
SynonymsP450RAI-2, CP26, retinoic acid B1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7672 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location84571414-84593908 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 84584369 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamine at position 104 (K104Q)
Ref Sequence ENSEMBL: ENSMUSP00000076886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077705] [ENSMUST00000168003] [ENSMUST00000204109] [ENSMUST00000204146] [ENSMUST00000205228]
Predicted Effect probably benign
Transcript: ENSMUST00000077705
AA Change: K104Q

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000076886
Gene: ENSMUSG00000063415
AA Change: K104Q

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:p450 50 490 8.1e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168003
AA Change: K104Q

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000128391
Gene: ENSMUSG00000063415
AA Change: K104Q

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:p450 50 490 8.1e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204109
SMART Domains Protein: ENSMUSP00000144998
Gene: ENSMUSG00000063415

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:p450 65 415 5.8e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204146
AA Change: K104Q

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000145092
Gene: ENSMUSG00000063415
AA Change: K104Q

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:p450 50 490 8.1e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205228
SMART Domains Protein: ENSMUSP00000144836
Gene: ENSMUSG00000063415

DomainStartEndE-ValueType
Pfam:p450 13 299 5.9e-49 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. The encoded protein is localized to the endoplasmic reticulum, and functions as a critical regulator of all-trans retinoic acid levels by the specific inactivation of all-trans retinoic acid to hydroxylated forms. Mutations in this gene are associated with radiohumeral fusions and other skeletal and craniofacial anomalies, and increased levels of the encoded protein are associated with atherosclerotic lesions. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2013]
PHENOTYPE: Limb morphogenesis and proximal-distal patterning is disrupted in homozygous null fetuses. Mutant mice are born, however they die immediately after birth exhibiting respiratory distress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik T C 7: 128,237,019 H134R probably damaging Het
Adcy4 A G 14: 55,780,905 M195T probably benign Het
Aktip T C 8: 91,129,657 N64S possibly damaging Het
Aldoart1 C A 4: 72,852,510 M20I probably benign Het
Alms1 T C 6: 85,615,351 L395P probably damaging Het
Ankrd9 C A 12: 110,976,746 V252F probably benign Het
Apof A T 10: 128,269,016 H13L probably benign Het
Bahcc1 T C 11: 120,283,346 F1644S possibly damaging Het
Baz2a A G 10: 128,123,857 D1377G possibly damaging Het
Bbox1 T A 2: 110,305,449 I62F probably damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 GTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTG GTTCTGTGGTCACTGATTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTG 3: 95,888,143 probably benign Het
BC028528 TCTGTGGTCACTGGT TCTGTGGTCACTGGTGCTGTGGTCACTGGT 3: 95,888,175 probably benign Het
Bcas3 C T 11: 85,395,387 R124* probably null Het
Bpnt1 T C 1: 185,346,682 V114A probably damaging Het
Ccnd1 C T 7: 144,934,056 R228H possibly damaging Het
Cd244 T C 1: 171,577,285 V235A probably benign Het
Cramp1l C T 17: 24,982,466 E681K probably damaging Het
Crebbp C T 16: 4,084,710 A2222T probably benign Het
Cyp1a2 T A 9: 57,682,337 T65S probably benign Het
D430041D05Rik T C 2: 104,241,236 I556V probably benign Het
Dnase1l2 A G 17: 24,442,245 L102P probably damaging Het
Elac1 C T 18: 73,738,854 G357S probably benign Het
Enam C A 5: 88,503,971 T1113N possibly damaging Het
Eogt A T 6: 97,113,909 I423N probably damaging Het
Epc2 T C 2: 49,545,819 S612P possibly damaging Het
Fam107b T C 2: 3,772,922 V24A probably damaging Het
Fam160b1 A G 19: 57,385,318 H670R possibly damaging Het
Foxj3 C T 4: 119,620,232 P413L unknown Het
Frg1 T C 8: 41,417,003 probably benign Het
Fsip2 T A 2: 82,990,111 V5396D possibly damaging Het
Gm49333 C A 16: 20,638,667 A483E probably damaging Het
Hdlbp T C 1: 93,437,099 T149A possibly damaging Het
Heatr1 A T 13: 12,438,664 Q2140L probably damaging Het
Iqcd T C 5: 120,606,816 L403P probably damaging Het
Kif1bp A G 10: 62,578,073 I102T probably benign Het
Kpna2 T G 11: 106,988,963 N505T probably benign Het
Lipo1 T A 19: 33,780,385 E228V probably benign Het
Map4k3 C T 17: 80,615,071 V474I possibly damaging Het
Mrpl11 T C 19: 4,962,396 S2P probably damaging Het
Mug2 A G 6: 122,040,719 I472V probably benign Het
Myom1 G A 17: 71,084,240 V915M possibly damaging Het
Nedd9 A T 13: 41,338,722 I104N possibly damaging Het
Nphp3 A G 9: 104,031,960 M790V probably benign Het
Nr3c2 C T 8: 76,909,209 P313L probably damaging Het
Obsl1 A G 1: 75,492,721 V1192A probably benign Het
Olfr1101 T C 2: 86,988,319 I286V possibly damaging Het
Olfr418 C T 1: 173,270,873 R233W probably benign Het
Olfr676 A G 7: 105,035,543 H115R probably damaging Het
Prr5l T G 2: 101,734,738 E151A probably damaging Het
Psmb8 G T 17: 34,198,430 R11L probably benign Het
Ptprg T A 14: 12,211,668 H983Q probably benign Het
Ptprj T C 2: 90,460,596 N600D possibly damaging Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Rc3h1 A G 1: 160,950,884 S460G probably damaging Het
Rhot2 A G 17: 25,843,105 probably null Het
Sall1 T C 8: 89,031,299 T726A probably damaging Het
Samd9l G A 6: 3,373,646 T1205I probably benign Het
Sh2b3 C T 5: 121,818,759 probably null Het
Slc22a18 G T 7: 143,490,820 C170F probably damaging Het
Slc24a1 G A 9: 64,947,927 T566I unknown Het
Slc4a5 T A 6: 83,260,535 C167S probably damaging Het
Slc8b1 T G 5: 120,533,035 V579G probably damaging Het
Snrnp200 T C 2: 127,221,902 V667A probably damaging Het
Sp8 C A 12: 118,849,335 S308R possibly damaging Het
Srsf9 T A 5: 115,330,560 V85E probably damaging Het
Syne1 T C 10: 5,218,527 I5285V probably benign Het
Tmem245 T C 4: 56,947,069 I115V probably benign Het
Triqk A G 4: 12,980,502 D82G probably benign Het
Trmt11 A T 10: 30,587,524 S198R probably damaging Het
Ube4b C T 4: 149,387,204 R75Q probably benign Het
Ugt3a1 C T 15: 9,310,693 Q354* probably null Het
Vmn1r202 A G 13: 22,501,680 V189A probably benign Het
Vmn2r26 A G 6: 124,039,647 I357V probably benign Het
Wdr6 T C 9: 108,573,748 K914R probably benign Het
Zfat T C 15: 68,258,686 M1V probably null Het
Zfp207 A G 11: 80,389,290 M171V probably benign Het
Zfp568 C T 7: 29,997,787 T44I probably damaging Het
Other mutations in Cyp26b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01713:Cyp26b1 APN 6 84574301 missense probably benign 0.00
IGL02530:Cyp26b1 APN 6 84574312 missense possibly damaging 0.95
IGL02624:Cyp26b1 APN 6 84584339 missense probably benign 0.00
IGL02676:Cyp26b1 APN 6 84576644 missense probably damaging 1.00
R0125:Cyp26b1 UTSW 6 84574515 missense probably damaging 1.00
R0127:Cyp26b1 UTSW 6 84577208 splice site probably benign
R0268:Cyp26b1 UTSW 6 84574572 missense probably damaging 1.00
R0281:Cyp26b1 UTSW 6 84574556 missense probably damaging 1.00
R0575:Cyp26b1 UTSW 6 84575306 splice site probably benign
R1167:Cyp26b1 UTSW 6 84584330 missense probably damaging 1.00
R1171:Cyp26b1 UTSW 6 84576671 missense possibly damaging 0.64
R1512:Cyp26b1 UTSW 6 84576997 missense probably benign 0.16
R1791:Cyp26b1 UTSW 6 84584459 missense probably benign 0.05
R1799:Cyp26b1 UTSW 6 84584272 missense probably benign 0.37
R2065:Cyp26b1 UTSW 6 84576555 missense probably benign 0.00
R2103:Cyp26b1 UTSW 6 84575050 missense possibly damaging 0.67
R2900:Cyp26b1 UTSW 6 84576641 missense possibly damaging 0.70
R4510:Cyp26b1 UTSW 6 84574491 missense probably damaging 1.00
R4511:Cyp26b1 UTSW 6 84574491 missense probably damaging 1.00
R4934:Cyp26b1 UTSW 6 84576972 missense possibly damaging 0.65
R5585:Cyp26b1 UTSW 6 84577189 missense probably damaging 0.99
R7229:Cyp26b1 UTSW 6 84577150 nonsense probably null
R7497:Cyp26b1 UTSW 6 84576982 missense possibly damaging 0.55
X0063:Cyp26b1 UTSW 6 84575118 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGAAGCTCAAATATCTGTGCC -3'
(R):5'- TGTTGCGGGGTGACAGAAAC -3'

Sequencing Primer
(F):5'- CCCTTACAGCAGGCAGTTAGTTAC -3'
(R):5'- GCCTAGTGTGGGGCAAG -3'
Posted On2019-11-12