Incidental Mutation 'R7672:Frg1'
ID592235
Institutional Source Beutler Lab
Gene Symbol Frg1
Ensembl Gene ENSMUSG00000031590
Gene NameFSHD region gene 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R7672 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location41397459-41417074 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) T to C at 41417003 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000033999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033999]
PDB Structure
Solution structure of mouse FRG1 protein [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000033999
SMART Domains Protein: ENSMUSP00000033999
Gene: ENSMUSG00000031590

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
Pfam:FRG1 67 256 4.2e-82 PFAM
Pfam:Fascin 92 180 3.6e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene maps to a location 100 kb centromeric of the repeat units on chromosome 4q35 which are deleted in facioscapulohumeral muscular dystrophy (FSHD). It is evolutionarily conserved and has related sequences on multiple human chromosomes but DNA sequence analysis did not reveal any homology to known genes. In vivo studies demonstrate the encoded protein is localized to the nucleolus. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik T C 7: 128,237,019 H134R probably damaging Het
Adcy4 A G 14: 55,780,905 M195T probably benign Het
Aktip T C 8: 91,129,657 N64S possibly damaging Het
Aldoart1 C A 4: 72,852,510 M20I probably benign Het
Alms1 T C 6: 85,615,351 L395P probably damaging Het
Ankrd9 C A 12: 110,976,746 V252F probably benign Het
Apof A T 10: 128,269,016 H13L probably benign Het
Bahcc1 T C 11: 120,283,346 F1644S possibly damaging Het
Baz2a A G 10: 128,123,857 D1377G possibly damaging Het
Bbox1 T A 2: 110,305,449 I62F probably damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 GTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTG GTTCTGTGGTCACTGATTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTG 3: 95,888,143 probably benign Het
BC028528 TCTGTGGTCACTGGT TCTGTGGTCACTGGTGCTGTGGTCACTGGT 3: 95,888,175 probably benign Het
Bcas3 C T 11: 85,395,387 R124* probably null Het
Bpnt1 T C 1: 185,346,682 V114A probably damaging Het
Ccnd1 C T 7: 144,934,056 R228H possibly damaging Het
Cd244 T C 1: 171,577,285 V235A probably benign Het
Cramp1l C T 17: 24,982,466 E681K probably damaging Het
Crebbp C T 16: 4,084,710 A2222T probably benign Het
Cyp1a2 T A 9: 57,682,337 T65S probably benign Het
Cyp26b1 T G 6: 84,584,369 K104Q probably benign Het
D430041D05Rik T C 2: 104,241,236 I556V probably benign Het
Dnase1l2 A G 17: 24,442,245 L102P probably damaging Het
Elac1 C T 18: 73,738,854 G357S probably benign Het
Enam C A 5: 88,503,971 T1113N possibly damaging Het
Eogt A T 6: 97,113,909 I423N probably damaging Het
Epc2 T C 2: 49,545,819 S612P possibly damaging Het
Fam107b T C 2: 3,772,922 V24A probably damaging Het
Fam160b1 A G 19: 57,385,318 H670R possibly damaging Het
Foxj3 C T 4: 119,620,232 P413L unknown Het
Fsip2 T A 2: 82,990,111 V5396D possibly damaging Het
Gm49333 C A 16: 20,638,667 A483E probably damaging Het
Hdlbp T C 1: 93,437,099 T149A possibly damaging Het
Heatr1 A T 13: 12,438,664 Q2140L probably damaging Het
Iqcd T C 5: 120,606,816 L403P probably damaging Het
Kif1bp A G 10: 62,578,073 I102T probably benign Het
Kpna2 T G 11: 106,988,963 N505T probably benign Het
Lipo1 T A 19: 33,780,385 E228V probably benign Het
Map4k3 C T 17: 80,615,071 V474I possibly damaging Het
Mrpl11 T C 19: 4,962,396 S2P probably damaging Het
Mug2 A G 6: 122,040,719 I472V probably benign Het
Myom1 G A 17: 71,084,240 V915M possibly damaging Het
Nedd9 A T 13: 41,338,722 I104N possibly damaging Het
Nphp3 A G 9: 104,031,960 M790V probably benign Het
Nr3c2 C T 8: 76,909,209 P313L probably damaging Het
Obsl1 A G 1: 75,492,721 V1192A probably benign Het
Olfr1101 T C 2: 86,988,319 I286V possibly damaging Het
Olfr418 C T 1: 173,270,873 R233W probably benign Het
Olfr676 A G 7: 105,035,543 H115R probably damaging Het
Prr5l T G 2: 101,734,738 E151A probably damaging Het
Psmb8 G T 17: 34,198,430 R11L probably benign Het
Ptprg T A 14: 12,211,668 H983Q probably benign Het
Ptprj T C 2: 90,460,596 N600D possibly damaging Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Rc3h1 A G 1: 160,950,884 S460G probably damaging Het
Rhot2 A G 17: 25,843,105 probably null Het
Sall1 T C 8: 89,031,299 T726A probably damaging Het
Samd9l G A 6: 3,373,646 T1205I probably benign Het
Sh2b3 C T 5: 121,818,759 probably null Het
Slc22a18 G T 7: 143,490,820 C170F probably damaging Het
Slc24a1 G A 9: 64,947,927 T566I unknown Het
Slc4a5 T A 6: 83,260,535 C167S probably damaging Het
Slc8b1 T G 5: 120,533,035 V579G probably damaging Het
Snrnp200 T C 2: 127,221,902 V667A probably damaging Het
Sp8 C A 12: 118,849,335 S308R possibly damaging Het
Srsf9 T A 5: 115,330,560 V85E probably damaging Het
Syne1 T C 10: 5,218,527 I5285V probably benign Het
Tmem245 T C 4: 56,947,069 I115V probably benign Het
Triqk A G 4: 12,980,502 D82G probably benign Het
Trmt11 A T 10: 30,587,524 S198R probably damaging Het
Ube4b C T 4: 149,387,204 R75Q probably benign Het
Ugt3a1 C T 15: 9,310,693 Q354* probably null Het
Vmn1r202 A G 13: 22,501,680 V189A probably benign Het
Vmn2r26 A G 6: 124,039,647 I357V probably benign Het
Wdr6 T C 9: 108,573,748 K914R probably benign Het
Zfat T C 15: 68,258,686 M1V probably null Het
Zfp207 A G 11: 80,389,290 M171V probably benign Het
Zfp568 C T 7: 29,997,787 T44I probably damaging Het
Other mutations in Frg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01541:Frg1 APN 8 41410325 splice site probably benign
IGL01562:Frg1 APN 8 41416909 missense possibly damaging 0.92
IGL03148:Frg1 APN 8 41411284 missense probably benign 0.00
R0180:Frg1 UTSW 8 41399068 critical splice acceptor site probably null
R1146:Frg1 UTSW 8 41411217 splice site probably benign
R2427:Frg1 UTSW 8 41414866 missense probably damaging 1.00
R3861:Frg1 UTSW 8 41407783 intron probably null
R4672:Frg1 UTSW 8 41400809 missense probably benign 0.30
R5981:Frg1 UTSW 8 41410270 missense possibly damaging 0.93
Z1176:Frg1 UTSW 8 41399638 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCAGCTAAGAAGTGTCGGGG -3'
(R):5'- GGCGTCTCTATAAGTTTTGCC -3'

Sequencing Primer
(F):5'- TGTCCACGCAGGTCTGAG -3'
(R):5'- AACATCCGGGACTTCGCC -3'
Posted On2019-11-12