Incidental Mutation 'R7672:Slc24a1'
ID592240
Institutional Source Beutler Lab
Gene Symbol Slc24a1
Ensembl Gene ENSMUSG00000034452
Gene Namesolute carrier family 24 (sodium/potassium/calcium exchanger), member 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R7672 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location64922861-64951607 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 64947927 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 566 (T566I)
Ref Sequence ENSEMBL: ENSMUSP00000035616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037798]
Predicted Effect unknown
Transcript: ENSMUST00000037798
AA Change: T566I
SMART Domains Protein: ENSMUSP00000035616
Gene: ENSMUSG00000034452
AA Change: T566I

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Na_Ca_ex 425 569 1.7e-28 PFAM
low complexity region 683 699 N/A INTRINSIC
coiled coil region 747 776 N/A INTRINSIC
coiled coil region 818 847 N/A INTRINSIC
coiled coil region 898 928 N/A INTRINSIC
transmembrane domain 939 956 N/A INTRINSIC
Pfam:Na_Ca_ex 967 1118 1.7e-33 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the potassium-dependent sodium/calcium exchanger protein family. The encoded protein plays an important role in sodium/calcium exchange in retinal rod and cone photoreceptors by mediating the extrusion of one calcium ion and one potassium ion in exchange for four sodium ions. Mutations in this gene may play a role in congenital stationary night blindness. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a null allele display slow progressive retinal degeneration and develop stationary night blindness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik T C 7: 128,237,019 H134R probably damaging Het
Adcy4 A G 14: 55,780,905 M195T probably benign Het
Aktip T C 8: 91,129,657 N64S possibly damaging Het
Aldoart1 C A 4: 72,852,510 M20I probably benign Het
Alms1 T C 6: 85,615,351 L395P probably damaging Het
Ankrd9 C A 12: 110,976,746 V252F probably benign Het
Apof A T 10: 128,269,016 H13L probably benign Het
Bahcc1 T C 11: 120,283,346 F1644S possibly damaging Het
Baz2a A G 10: 128,123,857 D1377G possibly damaging Het
Bbox1 T A 2: 110,305,449 I62F probably damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 GTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTG GTTCTGTGGTCACTGATTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTG 3: 95,888,143 probably benign Het
BC028528 TCTGTGGTCACTGGT TCTGTGGTCACTGGTGCTGTGGTCACTGGT 3: 95,888,175 probably benign Het
Bcas3 C T 11: 85,395,387 R124* probably null Het
Bpnt1 T C 1: 185,346,682 V114A probably damaging Het
Ccnd1 C T 7: 144,934,056 R228H possibly damaging Het
Cd244 T C 1: 171,577,285 V235A probably benign Het
Cramp1l C T 17: 24,982,466 E681K probably damaging Het
Crebbp C T 16: 4,084,710 A2222T probably benign Het
Cyp1a2 T A 9: 57,682,337 T65S probably benign Het
Cyp26b1 T G 6: 84,584,369 K104Q probably benign Het
D430041D05Rik T C 2: 104,241,236 I556V probably benign Het
Dnase1l2 A G 17: 24,442,245 L102P probably damaging Het
Elac1 C T 18: 73,738,854 G357S probably benign Het
Enam C A 5: 88,503,971 T1113N possibly damaging Het
Eogt A T 6: 97,113,909 I423N probably damaging Het
Epc2 T C 2: 49,545,819 S612P possibly damaging Het
Fam107b T C 2: 3,772,922 V24A probably damaging Het
Fam160b1 A G 19: 57,385,318 H670R possibly damaging Het
Foxj3 C T 4: 119,620,232 P413L unknown Het
Frg1 T C 8: 41,417,003 probably benign Het
Fsip2 T A 2: 82,990,111 V5396D possibly damaging Het
Gm49333 C A 16: 20,638,667 A483E probably damaging Het
Hdlbp T C 1: 93,437,099 T149A possibly damaging Het
Heatr1 A T 13: 12,438,664 Q2140L probably damaging Het
Iqcd T C 5: 120,606,816 L403P probably damaging Het
Kif1bp A G 10: 62,578,073 I102T probably benign Het
Kpna2 T G 11: 106,988,963 N505T probably benign Het
Lipo1 T A 19: 33,780,385 E228V probably benign Het
Map4k3 C T 17: 80,615,071 V474I possibly damaging Het
Mrpl11 T C 19: 4,962,396 S2P probably damaging Het
Mug2 A G 6: 122,040,719 I472V probably benign Het
Myom1 G A 17: 71,084,240 V915M possibly damaging Het
Nedd9 A T 13: 41,338,722 I104N possibly damaging Het
Nphp3 A G 9: 104,031,960 M790V probably benign Het
Nr3c2 C T 8: 76,909,209 P313L probably damaging Het
Obsl1 A G 1: 75,492,721 V1192A probably benign Het
Olfr1101 T C 2: 86,988,319 I286V possibly damaging Het
Olfr418 C T 1: 173,270,873 R233W probably benign Het
Olfr676 A G 7: 105,035,543 H115R probably damaging Het
Prr5l T G 2: 101,734,738 E151A probably damaging Het
Psmb8 G T 17: 34,198,430 R11L probably benign Het
Ptprg T A 14: 12,211,668 H983Q probably benign Het
Ptprj T C 2: 90,460,596 N600D possibly damaging Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Rc3h1 A G 1: 160,950,884 S460G probably damaging Het
Rhot2 A G 17: 25,843,105 probably null Het
Sall1 T C 8: 89,031,299 T726A probably damaging Het
Samd9l G A 6: 3,373,646 T1205I probably benign Het
Sh2b3 C T 5: 121,818,759 probably null Het
Slc22a18 G T 7: 143,490,820 C170F probably damaging Het
Slc4a5 T A 6: 83,260,535 C167S probably damaging Het
Slc8b1 T G 5: 120,533,035 V579G probably damaging Het
Snrnp200 T C 2: 127,221,902 V667A probably damaging Het
Sp8 C A 12: 118,849,335 S308R possibly damaging Het
Srsf9 T A 5: 115,330,560 V85E probably damaging Het
Syne1 T C 10: 5,218,527 I5285V probably benign Het
Tmem245 T C 4: 56,947,069 I115V probably benign Het
Triqk A G 4: 12,980,502 D82G probably benign Het
Trmt11 A T 10: 30,587,524 S198R probably damaging Het
Ube4b C T 4: 149,387,204 R75Q probably benign Het
Ugt3a1 C T 15: 9,310,693 Q354* probably null Het
Vmn1r202 A G 13: 22,501,680 V189A probably benign Het
Vmn2r26 A G 6: 124,039,647 I357V probably benign Het
Wdr6 T C 9: 108,573,748 K914R probably benign Het
Zfat T C 15: 68,258,686 M1V probably null Het
Zfp207 A G 11: 80,389,290 M171V probably benign Het
Zfp568 C T 7: 29,997,787 T44I probably damaging Het
Other mutations in Slc24a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Slc24a1 APN 9 64928019 missense probably damaging 0.99
IGL01602:Slc24a1 APN 9 64926181 missense probably damaging 1.00
IGL03111:Slc24a1 APN 9 64926326 missense probably damaging 0.98
R0092:Slc24a1 UTSW 9 64948752 missense unknown
R0708:Slc24a1 UTSW 9 64947890 missense unknown
R0827:Slc24a1 UTSW 9 64928190 missense probably benign 0.03
R1294:Slc24a1 UTSW 9 64936013 missense unknown
R1613:Slc24a1 UTSW 9 64948696 missense unknown
R2858:Slc24a1 UTSW 9 64949332 missense unknown
R3779:Slc24a1 UTSW 9 64948297 missense unknown
R3899:Slc24a1 UTSW 9 64928144 missense probably damaging 0.99
R3900:Slc24a1 UTSW 9 64928144 missense probably damaging 0.99
R4409:Slc24a1 UTSW 9 64948224 missense probably benign 0.39
R4732:Slc24a1 UTSW 9 64949554 missense probably benign 0.23
R4733:Slc24a1 UTSW 9 64949554 missense probably benign 0.23
R4745:Slc24a1 UTSW 9 64949476 missense unknown
R4915:Slc24a1 UTSW 9 64947931 missense unknown
R5371:Slc24a1 UTSW 9 64949268 missense unknown
R5448:Slc24a1 UTSW 9 64948327 missense probably benign 0.39
R5540:Slc24a1 UTSW 9 64948581 missense unknown
R5863:Slc24a1 UTSW 9 64928542 missense unknown
R6161:Slc24a1 UTSW 9 64937263 missense unknown
R6810:Slc24a1 UTSW 9 64948323 missense probably benign 0.39
R7215:Slc24a1 UTSW 9 64928503 missense unknown
R7380:Slc24a1 UTSW 9 64948533 missense unknown
R7453:Slc24a1 UTSW 9 64949301 missense unknown
R7466:Slc24a1 UTSW 9 64928404 missense unknown
R7488:Slc24a1 UTSW 9 64924482 missense probably benign 0.41
X0063:Slc24a1 UTSW 9 64949143 missense unknown
Predicted Primers PCR Primer
(F):5'- ATGGTCACAGGTTCTGATGG -3'
(R):5'- TTTGTCATCGGCACCTGTG -3'

Sequencing Primer
(F):5'- TCTGATGGCAGAGCACAGGC -3'
(R):5'- TGCCCTCTTCTCCCGGGAG -3'
Posted On2019-11-12