Incidental Mutation 'R7672:Myom1'
ID592267
Institutional Source Beutler Lab
Gene Symbol Myom1
Ensembl Gene ENSMUSG00000024049
Gene Namemyomesin 1
Synonymsskelemin, D430047A17Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7672 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location71019521-71126856 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 71084240 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 915 (V915M)
Ref Sequence ENSEMBL: ENSMUSP00000072945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024847] [ENSMUST00000073211] [ENSMUST00000179759]
PDB Structure
Skelemin Immunoglobulin C2 like domain 4 [SOLUTION NMR]
Skelemin Association with alfa2b,betta3 Integrin: A Structural Model [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000024847
AA Change: V817M

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000024847
Gene: ENSMUSG00000024049
AA Change: V817M

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
FN3 818 904 4.99e-11 SMART
FN3 923 1008 2.04e-16 SMART
IG 1025 1110 3.1e0 SMART
IG_like 1133 1219 1.34e1 SMART
IG_like 1253 1319 4.79e0 SMART
IG_like 1356 1433 1.54e2 SMART
IGc2 1469 1537 2.05e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000073211
AA Change: V915M

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000072945
Gene: ENSMUSG00000024049
AA Change: V915M

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
low complexity region 857 870 N/A INTRINSIC
FN3 916 1002 4.99e-11 SMART
FN3 1021 1106 2.04e-16 SMART
IG 1123 1208 3.1e0 SMART
IG_like 1231 1317 1.34e1 SMART
IG_like 1351 1417 4.79e0 SMART
IG_like 1454 1531 1.54e2 SMART
IGc2 1567 1635 2.05e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000179759
AA Change: V817M

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000136266
Gene: ENSMUSG00000024049
AA Change: V817M

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
FN3 818 904 4.99e-11 SMART
FN3 923 1008 2.04e-16 SMART
IG 1025 1110 3.1e0 SMART
IG_like 1133 1219 1.34e1 SMART
IG_like 1253 1319 4.79e0 SMART
IG_like 1356 1433 1.54e2 SMART
IGc2 1469 1537 2.05e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD (myomesin 1) and 165 kD (myomesin 2). This protein, myomesin 1, like myomesin 2, titin, and other myofibrillar proteins contains structural modules with strong homology to either fibronectin type III (motif I) or immunoglobulin C2 (motif II) domains. Myomesin 1 and myomesin 2 each have a unique N-terminal region followed by 12 modules of motif I or motif II, in the arrangement II-II-I-I-I-I-I-II-II-II-II-II. The two proteins share 50% sequence identity in this repeat-containing region. The head structure formed by these 2 proteins on one end of the titin string extends into the center of the M band. The integrating structure of the sarcomere arises from muscle-specific members of the superfamily of immunoglobulin-like proteins. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik T C 7: 128,237,019 H134R probably damaging Het
Adcy4 A G 14: 55,780,905 M195T probably benign Het
Aktip T C 8: 91,129,657 N64S possibly damaging Het
Aldoart1 C A 4: 72,852,510 M20I probably benign Het
Alms1 T C 6: 85,615,351 L395P probably damaging Het
Ankrd9 C A 12: 110,976,746 V252F probably benign Het
Apof A T 10: 128,269,016 H13L probably benign Het
Bahcc1 T C 11: 120,283,346 F1644S possibly damaging Het
Baz2a A G 10: 128,123,857 D1377G possibly damaging Het
Bbox1 T A 2: 110,305,449 I62F probably damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 GTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTG GTTCTGTGGTCACTGATTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTG 3: 95,888,143 probably benign Het
BC028528 TCTGTGGTCACTGGT TCTGTGGTCACTGGTGCTGTGGTCACTGGT 3: 95,888,175 probably benign Het
Bcas3 C T 11: 85,395,387 R124* probably null Het
Bpnt1 T C 1: 185,346,682 V114A probably damaging Het
Ccnd1 C T 7: 144,934,056 R228H possibly damaging Het
Cd244 T C 1: 171,577,285 V235A probably benign Het
Cramp1l C T 17: 24,982,466 E681K probably damaging Het
Crebbp C T 16: 4,084,710 A2222T probably benign Het
Cyp1a2 T A 9: 57,682,337 T65S probably benign Het
Cyp26b1 T G 6: 84,584,369 K104Q probably benign Het
D430041D05Rik T C 2: 104,241,236 I556V probably benign Het
Dnase1l2 A G 17: 24,442,245 L102P probably damaging Het
Elac1 C T 18: 73,738,854 G357S probably benign Het
Enam C A 5: 88,503,971 T1113N possibly damaging Het
Eogt A T 6: 97,113,909 I423N probably damaging Het
Epc2 T C 2: 49,545,819 S612P possibly damaging Het
Fam107b T C 2: 3,772,922 V24A probably damaging Het
Fam160b1 A G 19: 57,385,318 H670R possibly damaging Het
Foxj3 C T 4: 119,620,232 P413L unknown Het
Frg1 T C 8: 41,417,003 probably benign Het
Fsip2 T A 2: 82,990,111 V5396D possibly damaging Het
Gm49333 C A 16: 20,638,667 A483E probably damaging Het
Hdlbp T C 1: 93,437,099 T149A possibly damaging Het
Heatr1 A T 13: 12,438,664 Q2140L probably damaging Het
Iqcd T C 5: 120,606,816 L403P probably damaging Het
Kif1bp A G 10: 62,578,073 I102T probably benign Het
Kpna2 T G 11: 106,988,963 N505T probably benign Het
Lipo1 T A 19: 33,780,385 E228V probably benign Het
Map4k3 C T 17: 80,615,071 V474I possibly damaging Het
Mrpl11 T C 19: 4,962,396 S2P probably damaging Het
Mug2 A G 6: 122,040,719 I472V probably benign Het
Nedd9 A T 13: 41,338,722 I104N possibly damaging Het
Nphp3 A G 9: 104,031,960 M790V probably benign Het
Nr3c2 C T 8: 76,909,209 P313L probably damaging Het
Obsl1 A G 1: 75,492,721 V1192A probably benign Het
Olfr1101 T C 2: 86,988,319 I286V possibly damaging Het
Olfr418 C T 1: 173,270,873 R233W probably benign Het
Olfr676 A G 7: 105,035,543 H115R probably damaging Het
Prr5l T G 2: 101,734,738 E151A probably damaging Het
Psmb8 G T 17: 34,198,430 R11L probably benign Het
Ptprg T A 14: 12,211,668 H983Q probably benign Het
Ptprj T C 2: 90,460,596 N600D possibly damaging Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Rc3h1 A G 1: 160,950,884 S460G probably damaging Het
Rhot2 A G 17: 25,843,105 probably null Het
Sall1 T C 8: 89,031,299 T726A probably damaging Het
Samd9l G A 6: 3,373,646 T1205I probably benign Het
Sh2b3 C T 5: 121,818,759 probably null Het
Slc22a18 G T 7: 143,490,820 C170F probably damaging Het
Slc24a1 G A 9: 64,947,927 T566I unknown Het
Slc4a5 T A 6: 83,260,535 C167S probably damaging Het
Slc8b1 T G 5: 120,533,035 V579G probably damaging Het
Snrnp200 T C 2: 127,221,902 V667A probably damaging Het
Sp8 C A 12: 118,849,335 S308R possibly damaging Het
Srsf9 T A 5: 115,330,560 V85E probably damaging Het
Syne1 T C 10: 5,218,527 I5285V probably benign Het
Tmem245 T C 4: 56,947,069 I115V probably benign Het
Triqk A G 4: 12,980,502 D82G probably benign Het
Trmt11 A T 10: 30,587,524 S198R probably damaging Het
Ube4b C T 4: 149,387,204 R75Q probably benign Het
Ugt3a1 C T 15: 9,310,693 Q354* probably null Het
Vmn1r202 A G 13: 22,501,680 V189A probably benign Het
Vmn2r26 A G 6: 124,039,647 I357V probably benign Het
Wdr6 T C 9: 108,573,748 K914R probably benign Het
Zfat T C 15: 68,258,686 M1V probably null Het
Zfp207 A G 11: 80,389,290 M171V probably benign Het
Zfp568 C T 7: 29,997,787 T44I probably damaging Het
Other mutations in Myom1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Myom1 APN 17 71126098 missense probably damaging 1.00
IGL00845:Myom1 APN 17 71084429 missense probably damaging 1.00
IGL00904:Myom1 APN 17 71099949 splice site probably benign
IGL00928:Myom1 APN 17 71089913 missense probably damaging 1.00
IGL01025:Myom1 APN 17 71077917 missense probably damaging 1.00
IGL01548:Myom1 APN 17 71101220 splice site probably benign
IGL01588:Myom1 APN 17 71117437 missense possibly damaging 0.94
IGL01614:Myom1 APN 17 71126178 missense possibly damaging 0.46
IGL01618:Myom1 APN 17 71099993 missense possibly damaging 0.87
IGL01619:Myom1 APN 17 71044476 splice site probably benign
IGL01766:Myom1 APN 17 71077288 missense probably damaging 1.00
IGL02105:Myom1 APN 17 71047716 splice site probably benign
IGL02122:Myom1 APN 17 71092137 missense probably damaging 1.00
IGL02184:Myom1 APN 17 71072137 missense possibly damaging 0.93
IGL02260:Myom1 APN 17 71108315 nonsense probably null
IGL02486:Myom1 APN 17 71099944 splice site probably benign
IGL02501:Myom1 APN 17 71072081 critical splice acceptor site probably null
IGL02642:Myom1 APN 17 71101098 missense possibly damaging 0.90
IGL02677:Myom1 APN 17 71084349 missense probably damaging 1.00
IGL02719:Myom1 APN 17 71106354 splice site probably benign
IGL02945:Myom1 APN 17 71092093 splice site probably benign
IGL03086:Myom1 APN 17 71108671 missense probably damaging 1.00
IGL03218:Myom1 APN 17 71084316 missense possibly damaging 0.46
R0107:Myom1 UTSW 17 71077365 missense probably damaging 1.00
R0130:Myom1 UTSW 17 71045755 missense probably damaging 0.98
R0133:Myom1 UTSW 17 71047787 missense probably damaging 1.00
R0206:Myom1 UTSW 17 71037297 missense probably damaging 1.00
R0206:Myom1 UTSW 17 71037297 missense probably damaging 1.00
R0352:Myom1 UTSW 17 71045749 missense possibly damaging 0.72
R0396:Myom1 UTSW 17 71034693 missense probably damaging 1.00
R0496:Myom1 UTSW 17 71084306 missense probably damaging 1.00
R0506:Myom1 UTSW 17 71092220 splice site probably benign
R0511:Myom1 UTSW 17 71084317 missense probably benign 0.22
R0600:Myom1 UTSW 17 71120648 missense possibly damaging 0.48
R0699:Myom1 UTSW 17 71067313 missense probably damaging 0.98
R0791:Myom1 UTSW 17 71121136 missense probably damaging 1.00
R0792:Myom1 UTSW 17 71121136 missense probably damaging 1.00
R0963:Myom1 UTSW 17 71077767 missense possibly damaging 0.74
R1324:Myom1 UTSW 17 71052719 missense probably damaging 0.98
R2102:Myom1 UTSW 17 71101029 missense probably damaging 1.00
R2158:Myom1 UTSW 17 71064597 missense possibly damaging 0.83
R2336:Myom1 UTSW 17 71023194 missense possibly damaging 0.53
R2351:Myom1 UTSW 17 71034579 missense probably damaging 0.98
R2442:Myom1 UTSW 17 71110735 missense probably damaging 1.00
R2483:Myom1 UTSW 17 71077812 missense probably damaging 1.00
R2892:Myom1 UTSW 17 71034653 missense probably damaging 1.00
R2897:Myom1 UTSW 17 71101220 splice site probably benign
R3440:Myom1 UTSW 17 71045663 splice site probably null
R3842:Myom1 UTSW 17 71045624 missense probably damaging 1.00
R4249:Myom1 UTSW 17 71092140 missense probably damaging 1.00
R4329:Myom1 UTSW 17 71036353 missense probably damaging 1.00
R4594:Myom1 UTSW 17 71100074 missense possibly damaging 0.73
R4873:Myom1 UTSW 17 71072119 missense probably damaging 1.00
R4875:Myom1 UTSW 17 71072119 missense probably damaging 1.00
R4876:Myom1 UTSW 17 71077410 missense probably damaging 1.00
R5171:Myom1 UTSW 17 71099972 missense possibly damaging 0.94
R5540:Myom1 UTSW 17 71109787 missense probably damaging 1.00
R5882:Myom1 UTSW 17 71110722 missense probably damaging 1.00
R5978:Myom1 UTSW 17 71117443 missense probably damaging 1.00
R6039:Myom1 UTSW 17 71110751 missense probably damaging 1.00
R6039:Myom1 UTSW 17 71110751 missense probably damaging 1.00
R6155:Myom1 UTSW 17 71108695 critical splice donor site probably null
R6261:Myom1 UTSW 17 71126137 missense probably damaging 1.00
R6284:Myom1 UTSW 17 71022892 nonsense probably null
R6313:Myom1 UTSW 17 71082488 missense probably benign
R6369:Myom1 UTSW 17 71101076 missense probably damaging 1.00
R6545:Myom1 UTSW 17 71082305 missense probably benign 0.00
R6738:Myom1 UTSW 17 71100398 splice site probably null
R6933:Myom1 UTSW 17 71052671 missense probably damaging 1.00
R7168:Myom1 UTSW 17 71089947 missense probably benign 0.00
R7286:Myom1 UTSW 17 71045549 missense possibly damaging 0.90
R7315:Myom1 UTSW 17 71080897 critical splice donor site probably null
R7789:Myom1 UTSW 17 71117436 missense probably benign 0.03
R7898:Myom1 UTSW 17 71045752 missense probably benign 0.25
R8008:Myom1 UTSW 17 71100062 missense probably benign 0.30
R8152:Myom1 UTSW 17 71084295 missense probably damaging 0.96
X0019:Myom1 UTSW 17 71100071 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- GGACATGCCATTTTGCCAG -3'
(R):5'- GGCCTTGATGTTAGCTTCCC -3'

Sequencing Primer
(F):5'- TTGCGTCCTATGTCTAGC -3'
(R):5'- GATGTTAGCTTCCCTCCATTTTCCTG -3'
Posted On2019-11-12