Incidental Mutation 'R7673:Slc4a3'
ID592276
Institutional Source Beutler Lab
Gene Symbol Slc4a3
Ensembl Gene ENSMUSG00000006576
Gene Namesolute carrier family 4 (anion exchanger), member 3
SynonymsA930038D23Rik, Ae3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R7673 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location75546266-75562172 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75557351 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1114 (V1114A)
Ref Sequence ENSEMBL: ENSMUSP00000116747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027415] [ENSMUST00000124341]
Predicted Effect probably benign
Transcript: ENSMUST00000027415
SMART Domains Protein: ENSMUSP00000027415
Gene: ENSMUSG00000006576

DomainStartEndE-ValueType
low complexity region 74 83 N/A INTRINSIC
low complexity region 88 100 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 128 161 N/A INTRINSIC
low complexity region 194 216 N/A INTRINSIC
low complexity region 304 316 N/A INTRINSIC
Pfam:Band_3_cyto 349 500 7.9e-39 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000124341
AA Change: V1114A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000116747
Gene: ENSMUSG00000006576
AA Change: V1114A

DomainStartEndE-ValueType
low complexity region 74 83 N/A INTRINSIC
low complexity region 88 100 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 128 161 N/A INTRINSIC
low complexity region 194 216 N/A INTRINSIC
low complexity region 304 316 N/A INTRINSIC
Pfam:Band_3_cyto 349 618 2.9e-106 PFAM
low complexity region 629 639 N/A INTRINSIC
Pfam:HCO3_cotransp 674 1156 3.6e-203 PFAM
transmembrane domain 1161 1183 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132110
SMART Domains Protein: ENSMUSP00000119942
Gene: ENSMUSG00000006576

DomainStartEndE-ValueType
SCOP:d1hynp_ 4 72 9e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145258
SMART Domains Protein: ENSMUSP00000119860
Gene: ENSMUSG00000006576

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
Pfam:Band_3_cyto 50 193 4.2e-42 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a plasma membrane anion exchange protein. The encoded protein has been found in brain, heart, kidney, small intestine, and lung. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygotes for one knock-out allele show inner retina defects including selective ERG b-wave depression, optic nerve and retinal vessel anomalies, sheathing of retinal vessels and late onset photoreceptor death. Homozygotes for another knock-out allele are more sensitive to seizure-inducing agents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh C A 5: 76,882,708 A682S probably benign Het
Acad11 A T 9: 104,063,906 probably null Het
Ahctf1 A T 1: 179,762,846 D1287E probably benign Het
Aldh9a1 C A 1: 167,361,550 L360M probably benign Het
Ank3 A T 10: 69,990,501 I1667F Het
Atp8b3 A G 10: 80,524,406 Y944H probably damaging Het
Ccdc30 T C 4: 119,353,172 D316G probably damaging Het
Ccdc50 T C 16: 27,406,675 I46T possibly damaging Het
Cfap74 T G 4: 155,463,056 I1233S unknown Het
Chd9 A G 8: 91,051,697 M2779V probably damaging Het
Cmya5 A T 13: 93,094,121 D1486E probably benign Het
Creb3 T C 4: 43,563,117 V72A not run Het
Cxcl17 C A 7: 25,402,868 C50F probably damaging Het
Dcaf11 C A 14: 55,569,305 N528K probably benign Het
Ddx46 T C 13: 55,659,159 V535A probably benign Het
Det1 A T 7: 78,843,611 V215D possibly damaging Het
Dnaja3 A G 16: 4,694,464 N244S probably benign Het
Dnajc13 G T 9: 104,233,692 P127T probably benign Het
Dnm2 T A 9: 21,481,421 probably null Het
Fam117a G T 11: 95,371,496 R142L probably benign Het
Fpr-rs6 T C 17: 20,182,737 M121V probably benign Het
Gatad1 T C 5: 3,646,867 T95A probably benign Het
Gdap2 A G 3: 100,191,699 D369G probably benign Het
Gm12185 A T 11: 48,907,628 D679E probably benign Het
Gm5519 G C 19: 33,825,028 G157A probably benign Het
Gm960 A C 19: 4,645,633 D530E probably damaging Het
Gmeb2 T A 2: 181,260,388 H123L probably benign Het
Golgb1 C T 16: 36,913,669 P1134S probably benign Het
Gsdmc2 G T 15: 63,825,083 A413D probably damaging Het
Hck C T 2: 153,129,085 A89V possibly damaging Het
Heatr5b G A 17: 78,795,983 T1147M probably damaging Het
Hoxb2 A T 11: 96,353,457 D298V possibly damaging Het
Hrc A G 7: 45,337,234 E603G probably benign Het
Hsd3b5 C A 3: 98,619,441 A230S probably damaging Het
Hsh2d A G 8: 72,200,511 S246G probably benign Het
Ifna4 A C 4: 88,842,072 Q71P possibly damaging Het
Il4i1 A G 7: 44,840,362 E517G probably benign Het
Kdm6b A C 11: 69,405,742 S566R probably damaging Het
Lamc2 T A 1: 153,124,036 Q1192H probably damaging Het
Map2 T C 1: 66,413,774 S608P probably benign Het
March9 T C 10: 127,056,599 E340G probably damaging Het
Mcm3 A G 1: 20,812,014 L442P probably damaging Het
Mreg A C 1: 72,160,964 M189R probably benign Het
Myh4 A T 11: 67,245,513 R406W probably damaging Het
Nol8 A G 13: 49,664,780 D842G probably benign Het
Nrros T A 16: 32,162,281 I10F unknown Het
Obscn G A 11: 59,027,437 P210S Het
Olfr1085 T C 2: 86,657,726 H244R probably damaging Het
Olfr1312 T A 2: 112,042,580 M151L probably benign Het
Olfr889 A T 9: 38,116,227 T149S probably benign Het
Olfr998 T C 2: 85,591,062 I174T possibly damaging Het
Orai1 A G 5: 123,029,442 H226R probably benign Het
Pcdhb18 G T 18: 37,491,737 V707L probably benign Het
Pex5 A T 6: 124,399,383 L420Q probably damaging Het
Rab8a A G 8: 72,161,296 probably benign Het
Rexo4 G A 2: 26,958,493 H339Y probably benign Het
Rif1 G A 2: 52,088,654 V369M probably damaging Het
Rpgrip1l A T 8: 91,300,787 I208K possibly damaging Het
Sbno1 G A 5: 124,413,216 P68L probably benign Het
Selenop G T 15: 3,274,858 C62F probably damaging Het
Slc13a4 A T 6: 35,276,476 V397D probably damaging Het
Stard3nl A T 13: 19,367,753 S214T probably benign Het
Stra8 T A 6: 34,927,918 probably null Het
Stx8 T C 11: 67,984,639 F97L probably benign Het
Thsd7b A G 1: 129,915,750 probably null Het
Tmem94 T C 11: 115,788,378 I251T probably benign Het
Toporsl A T 4: 52,610,679 T191S probably damaging Het
Vmn1r53 T A 6: 90,223,643 E233V probably damaging Het
Wdr49 A T 3: 75,450,907 L177Q probably damaging Het
Wnt8b T C 19: 44,511,688 L238P possibly damaging Het
Xirp2 T C 2: 67,517,087 V3224A probably damaging Het
Zfp583 G T 7: 6,317,010 N334K possibly damaging Het
Zfp60 T A 7: 27,748,315 I136N probably benign Het
Zmynd15 G T 11: 70,466,040 R722L unknown Het
Other mutations in Slc4a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Slc4a3 APN 1 75555083 missense probably damaging 1.00
IGL00979:Slc4a3 APN 1 75554247 missense probably damaging 1.00
IGL01488:Slc4a3 APN 1 75548876 missense probably benign 0.45
IGL01567:Slc4a3 APN 1 75550882 missense probably damaging 1.00
IGL03090:Slc4a3 APN 1 75555017 missense probably benign 0.00
IGL03135:Slc4a3 APN 1 75547935 unclassified probably benign
R0004:Slc4a3 UTSW 1 75557009 unclassified probably benign
R0479:Slc4a3 UTSW 1 75551828 unclassified probably benign
R0507:Slc4a3 UTSW 1 75556081 missense probably damaging 1.00
R0591:Slc4a3 UTSW 1 75549021 missense probably damaging 1.00
R0742:Slc4a3 UTSW 1 75556081 missense probably damaging 1.00
R1577:Slc4a3 UTSW 1 75550891 missense probably damaging 1.00
R1794:Slc4a3 UTSW 1 75557308 missense probably damaging 0.99
R1804:Slc4a3 UTSW 1 75551717 missense probably damaging 1.00
R1911:Slc4a3 UTSW 1 75553723 missense probably damaging 1.00
R1974:Slc4a3 UTSW 1 75552191 nonsense probably null
R2696:Slc4a3 UTSW 1 75555475 missense possibly damaging 0.46
R2995:Slc4a3 UTSW 1 75552662 nonsense probably null
R3962:Slc4a3 UTSW 1 75556754 missense probably damaging 0.99
R4025:Slc4a3 UTSW 1 75549041 missense probably damaging 1.00
R4824:Slc4a3 UTSW 1 75550623 missense possibly damaging 0.54
R4858:Slc4a3 UTSW 1 75555085 missense probably damaging 1.00
R5075:Slc4a3 UTSW 1 75557368 missense probably damaging 1.00
R5450:Slc4a3 UTSW 1 75552656 missense probably damaging 1.00
R5636:Slc4a3 UTSW 1 75554216 missense possibly damaging 0.82
R5728:Slc4a3 UTSW 1 75549840 missense probably benign 0.05
R5921:Slc4a3 UTSW 1 75557444 critical splice donor site probably null
R5969:Slc4a3 UTSW 1 75549979 missense probably damaging 0.98
R6272:Slc4a3 UTSW 1 75554697 critical splice donor site probably null
R6749:Slc4a3 UTSW 1 75554538 nonsense probably null
R6788:Slc4a3 UTSW 1 75551315 missense probably damaging 1.00
R7308:Slc4a3 UTSW 1 75557362 missense probably benign 0.00
R7487:Slc4a3 UTSW 1 75553377 missense probably benign 0.05
R7968:Slc4a3 UTSW 1 75551363 missense probably benign 0.00
R8004:Slc4a3 UTSW 1 75549067 critical splice donor site probably null
R8084:Slc4a3 UTSW 1 75555945 missense probably benign 0.25
R8109:Slc4a3 UTSW 1 75551804 missense possibly damaging 0.88
R8221:Slc4a3 UTSW 1 75552166 missense probably benign 0.02
R8358:Slc4a3 UTSW 1 75553715 missense probably damaging 1.00
Z1176:Slc4a3 UTSW 1 75554235 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGATCCACCTCTGTCAAGAAGG -3'
(R):5'- TTGGGGAACATGGCTCTCTG -3'

Sequencing Primer
(F):5'- CTCTGTCAAGAAGGCCCAGATTG -3'
(R):5'- AACATGGCTCTCTGGGTCC -3'
Posted On2019-11-12