Incidental Mutation 'R7673:Lamc2'
ID592277
Institutional Source Beutler Lab
Gene Symbol Lamc2
Ensembl Gene ENSMUSG00000026479
Gene Namelaminin, gamma 2
Synonymsnicein, 100kDa
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.800) question?
Stock #R7673 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location153122756-153186447 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 153124036 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 1192 (Q1192H)
Ref Sequence ENSEMBL: ENSMUSP00000140514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027753] [ENSMUST00000043313] [ENSMUST00000185356] [ENSMUST00000186368] [ENSMUST00000188206]
Predicted Effect probably damaging
Transcript: ENSMUST00000027753
AA Change: Q1192H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027753
Gene: ENSMUSG00000026479
AA Change: Q1192H

DomainStartEndE-ValueType
EGF_Lam 28 81 1.03e-7 SMART
EGF_Lam 84 128 2.14e-14 SMART
EGF_Lam 139 184 4.52e-13 SMART
LamB 245 370 7.58e-46 SMART
EGF_like 370 413 3.83e0 SMART
Blast:EGF_like 417 460 8e-23 BLAST
EGF_Lam 462 514 1.95e-8 SMART
EGF_Lam 517 570 1.88e-10 SMART
EGF_like 573 610 2.6e-1 SMART
coiled coil region 612 680 N/A INTRINSIC
low complexity region 792 817 N/A INTRINSIC
coiled coil region 952 994 N/A INTRINSIC
low complexity region 1016 1027 N/A INTRINSIC
coiled coil region 1039 1072 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000043313
SMART Domains Protein: ENSMUSP00000041110
Gene: ENSMUSG00000042751

DomainStartEndE-ValueType
Pfam:CTP_transf_like 12 276 2e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000185356
AA Change: Q1192H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140514
Gene: ENSMUSG00000026479
AA Change: Q1192H

DomainStartEndE-ValueType
EGF_Lam 28 81 1.03e-7 SMART
EGF_Lam 84 128 2.14e-14 SMART
EGF_Lam 139 184 4.52e-13 SMART
LamB 245 370 7.58e-46 SMART
EGF_like 370 413 3.83e0 SMART
Blast:EGF_like 417 460 8e-23 BLAST
EGF_Lam 462 514 1.95e-8 SMART
EGF_Lam 517 570 1.88e-10 SMART
EGF_like 573 610 2.6e-1 SMART
coiled coil region 612 680 N/A INTRINSIC
low complexity region 792 817 N/A INTRINSIC
coiled coil region 952 994 N/A INTRINSIC
low complexity region 1016 1027 N/A INTRINSIC
coiled coil region 1039 1072 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186368
SMART Domains Protein: ENSMUSP00000140585
Gene: ENSMUSG00000042751

DomainStartEndE-ValueType
Pfam:CTP_transf_2 12 275 2e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188206
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), have a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 2. The gamma 2 chain, formerly thought to be a truncated version of beta chain (B2t), is highly homologous to the gamma 1 chain; however, it lacks domain VI, and domains V, IV and III are shorter. It is expressed in several fetal tissues but differently from gamma 1, and is specifically localized to epithelial cells in skin, lung and kidney. The gamma 2 chain together with alpha 3 and beta 3 chains constitute laminin 5 (earlier known as kalinin), which is an integral part of the anchoring filaments that connect epithelial cells to the underlying basement membrane. The epithelium-specific expression of the gamma 2 chain implied its role as an epithelium attachment molecule, and mutations in this gene have been associated with junctional epidermolysis bullosa, a skin disease characterized by blisters due to disruption of the epidermal-dermal junction. Two transcript variants resulting from alternative splicing of the 3' terminal exon, and encoding different isoforms of gamma 2 chain, have been described. The two variants are differentially expressed in embryonic tissues, however, the biological significance of the two forms is not known. Transcript variants utilizing alternative polyA_signal have also been noted in literature. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in cell:cell adhesion involving epithelial cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh C A 5: 76,882,708 A682S probably benign Het
Ahctf1 A T 1: 179,762,846 D1287E probably benign Het
Aldh9a1 C A 1: 167,361,550 L360M probably benign Het
Ank3 A T 10: 69,990,501 I1667F Het
Atp8b3 A G 10: 80,524,406 Y944H probably damaging Het
Ccdc30 T C 4: 119,353,172 D316G probably damaging Het
Ccdc50 T C 16: 27,406,675 I46T possibly damaging Het
Cfap74 T G 4: 155,463,056 I1233S unknown Het
Chd9 A G 8: 91,051,697 M2779V probably damaging Het
Cmya5 A T 13: 93,094,121 D1486E probably benign Het
Creb3 T C 4: 43,563,117 V72A not run Het
Cxcl17 C A 7: 25,402,868 C50F probably damaging Het
Dcaf11 C A 14: 55,569,305 N528K probably benign Het
Ddx46 T C 13: 55,659,159 V535A probably benign Het
Det1 A T 7: 78,843,611 V215D possibly damaging Het
Dnaja3 A G 16: 4,694,464 N244S probably benign Het
Dnajc13 G T 9: 104,233,692 P127T probably benign Het
Dnm2 T A 9: 21,481,421 probably null Het
Fam117a G T 11: 95,371,496 R142L probably benign Het
Fpr-rs6 T C 17: 20,182,737 M121V probably benign Het
Gatad1 T C 5: 3,646,867 T95A probably benign Het
Gdap2 A G 3: 100,191,699 D369G probably benign Het
Gm12185 A T 11: 48,907,628 D679E probably benign Het
Gm5519 G C 19: 33,825,028 G157A probably benign Het
Gm960 A C 19: 4,645,633 D530E probably damaging Het
Gmeb2 T A 2: 181,260,388 H123L probably benign Het
Golgb1 C T 16: 36,913,669 P1134S probably benign Het
Gsdmc2 G T 15: 63,825,083 A413D probably damaging Het
Hck C T 2: 153,129,085 A89V possibly damaging Het
Heatr5b G A 17: 78,795,983 T1147M probably damaging Het
Hoxb2 A T 11: 96,353,457 D298V possibly damaging Het
Hrc A G 7: 45,337,234 E603G probably benign Het
Hsd3b5 C A 3: 98,619,441 A230S probably damaging Het
Hsh2d A G 8: 72,200,511 S246G probably benign Het
Ifna4 A C 4: 88,842,072 Q71P possibly damaging Het
Il4i1 A G 7: 44,840,362 E517G probably benign Het
Kdm6b A C 11: 69,405,742 S566R probably damaging Het
Map2 T C 1: 66,413,774 S608P probably benign Het
March9 T C 10: 127,056,599 E340G probably damaging Het
Mcm3 A G 1: 20,812,014 L442P probably damaging Het
Mreg A C 1: 72,160,964 M189R probably benign Het
Myh4 A T 11: 67,245,513 R406W probably damaging Het
Nol8 A G 13: 49,664,780 D842G probably benign Het
Nrros T A 16: 32,162,281 I10F unknown Het
Obscn G A 11: 59,027,437 P210S Het
Olfr1085 T C 2: 86,657,726 H244R probably damaging Het
Olfr1312 T A 2: 112,042,580 M151L probably benign Het
Olfr889 A T 9: 38,116,227 T149S probably benign Het
Olfr998 T C 2: 85,591,062 I174T possibly damaging Het
Orai1 A G 5: 123,029,442 H226R probably benign Het
Pcdhb18 G T 18: 37,491,737 V707L probably benign Het
Pex5 A T 6: 124,399,383 L420Q probably damaging Het
Rab8a A G 8: 72,161,296 probably benign Het
Rexo4 G A 2: 26,958,493 H339Y probably benign Het
Rif1 G A 2: 52,088,654 V369M probably damaging Het
Rpgrip1l A T 8: 91,300,787 I208K possibly damaging Het
Sbno1 G A 5: 124,413,216 P68L probably benign Het
Selenop G T 15: 3,274,858 C62F probably damaging Het
Slc13a4 A T 6: 35,276,476 V397D probably damaging Het
Slc4a3 T C 1: 75,557,351 V1114A probably damaging Het
Stard3nl A T 13: 19,367,753 S214T probably benign Het
Stra8 T A 6: 34,927,918 probably null Het
Stx8 T C 11: 67,984,639 F97L probably benign Het
Tmem94 T C 11: 115,788,378 I251T probably benign Het
Toporsl A T 4: 52,610,679 T191S probably damaging Het
Vmn1r53 T A 6: 90,223,643 E233V probably damaging Het
Wdr49 A T 3: 75,450,907 L177Q probably damaging Het
Wnt8b T C 19: 44,511,688 L238P possibly damaging Het
Xirp2 T C 2: 67,517,087 V3224A probably damaging Het
Zfp583 G T 7: 6,317,010 N334K possibly damaging Het
Zfp60 T A 7: 27,748,315 I136N probably benign Het
Zmynd15 G T 11: 70,466,040 R722L unknown Het
Other mutations in Lamc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Lamc2 APN 1 153130056 missense probably benign 0.00
IGL00907:Lamc2 APN 1 153144651 missense probably benign 0.32
IGL02026:Lamc2 APN 1 153144736 splice site probably benign
IGL02335:Lamc2 APN 1 153166216 missense probably benign 0.00
IGL02568:Lamc2 APN 1 153166262 missense possibly damaging 0.91
IGL02640:Lamc2 APN 1 153152057 missense probably damaging 0.99
IGL02801:Lamc2 APN 1 153136783 missense probably benign 0.10
IGL02827:Lamc2 APN 1 153139781 missense probably damaging 1.00
IGL03240:Lamc2 APN 1 153124125 missense probably damaging 1.00
IGL03245:Lamc2 APN 1 153133757 splice site probably null
ANU74:Lamc2 UTSW 1 153131835 missense probably benign 0.00
R0279:Lamc2 UTSW 1 153130696 missense probably benign 0.01
R0528:Lamc2 UTSW 1 153124094 missense probably damaging 1.00
R0597:Lamc2 UTSW 1 153133621 missense probably benign 0.02
R0650:Lamc2 UTSW 1 153143876 missense possibly damaging 0.88
R0826:Lamc2 UTSW 1 153152082 missense probably damaging 1.00
R1015:Lamc2 UTSW 1 153166199 missense possibly damaging 0.53
R1172:Lamc2 UTSW 1 153166287 missense probably damaging 1.00
R1308:Lamc2 UTSW 1 153150818 missense probably damaging 1.00
R1521:Lamc2 UTSW 1 153166263 missense probably benign 0.11
R1525:Lamc2 UTSW 1 153130756 missense probably benign 0.00
R1602:Lamc2 UTSW 1 153127028 missense probably benign 0.00
R1631:Lamc2 UTSW 1 153158934 missense possibly damaging 0.95
R1633:Lamc2 UTSW 1 153141698 nonsense probably null
R1832:Lamc2 UTSW 1 153166187 missense possibly damaging 0.72
R1978:Lamc2 UTSW 1 153133597 critical splice donor site probably null
R1996:Lamc2 UTSW 1 153154470 missense possibly damaging 0.84
R2046:Lamc2 UTSW 1 153141765 missense probably benign 0.01
R2107:Lamc2 UTSW 1 153154386 splice site probably benign
R2130:Lamc2 UTSW 1 153127124 missense probably damaging 1.00
R2182:Lamc2 UTSW 1 153126866 missense possibly damaging 0.46
R2207:Lamc2 UTSW 1 153133706 missense possibly damaging 0.68
R2218:Lamc2 UTSW 1 153130779 missense probably benign 0.21
R3772:Lamc2 UTSW 1 153124251 missense probably benign
R4616:Lamc2 UTSW 1 153166169 missense probably damaging 1.00
R4874:Lamc2 UTSW 1 153154395 missense probably null 1.00
R4939:Lamc2 UTSW 1 153126836 missense probably damaging 1.00
R4985:Lamc2 UTSW 1 153136805 missense probably benign
R5544:Lamc2 UTSW 1 153124053 missense possibly damaging 0.93
R5632:Lamc2 UTSW 1 153131890 missense probably damaging 1.00
R5771:Lamc2 UTSW 1 153141594 missense probably benign 0.04
R5811:Lamc2 UTSW 1 153166253 missense possibly damaging 0.53
R6058:Lamc2 UTSW 1 153136829 missense probably benign 0.01
R6130:Lamc2 UTSW 1 153136777 missense probably benign 0.01
R6137:Lamc2 UTSW 1 153166153 missense possibly damaging 0.90
R6994:Lamc2 UTSW 1 153136762 missense probably benign 0.18
R6995:Lamc2 UTSW 1 153136762 missense probably benign 0.18
R6997:Lamc2 UTSW 1 153136762 missense probably benign 0.18
R7000:Lamc2 UTSW 1 153166127 missense possibly damaging 0.72
R7018:Lamc2 UTSW 1 153136742 missense probably benign 0.00
R7145:Lamc2 UTSW 1 153130772 missense possibly damaging 0.95
R7148:Lamc2 UTSW 1 153185984 missense probably benign 0.01
R7171:Lamc2 UTSW 1 153139749 missense probably damaging 1.00
R7640:Lamc2 UTSW 1 153136804 missense possibly damaging 0.79
R7684:Lamc2 UTSW 1 153127025 missense probably null 0.86
R7712:Lamc2 UTSW 1 153133611 missense possibly damaging 0.81
RF024:Lamc2 UTSW 1 153152055 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- CAACGCTATCTGCCTCACTG -3'
(R):5'- AGATCAACAGTCGACTTCGG -3'

Sequencing Primer
(F):5'- TGCCAGCATCAGGAAGC -3'
(R):5'- AGTCGACTTCGGCCCTTGATG -3'
Posted On2019-11-12