Incidental Mutation 'R7673:Rif1'
ID 592281
Institutional Source Beutler Lab
Gene Symbol Rif1
Ensembl Gene ENSMUSG00000036202
Gene Name replication timing regulatory factor 1
Synonyms D2Ertd145e, 6530403D07Rik, 5730435J01Rik
MMRRC Submission 045743-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7673 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 51962844-52012395 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 51978666 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 369 (V369M)
Ref Sequence ENSEMBL: ENSMUSP00000108313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112693]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000112693
AA Change: V369M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108313
Gene: ENSMUSG00000036202
AA Change: V369M

DomainStartEndE-ValueType
Pfam:Rif1_N 18 381 1.4e-85 PFAM
low complexity region 432 444 N/A INTRINSIC
low complexity region 586 598 N/A INTRINSIC
low complexity region 1018 1038 N/A INTRINSIC
low complexity region 1180 1205 N/A INTRINSIC
low complexity region 1310 1321 N/A INTRINSIC
low complexity region 1423 1446 N/A INTRINSIC
low complexity region 1576 1586 N/A INTRINSIC
low complexity region 1677 1690 N/A INTRINSIC
low complexity region 1702 1712 N/A INTRINSIC
low complexity region 2176 2195 N/A INTRINSIC
Meta Mutation Damage Score 0.6668 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that shares homology with the yeast teleomere binding protein, Rap1 interacting factor 1. This protein localizes to aberrant telomeres may be involved in DNA repair. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice homozygous for a gene trap allele exhibit embryonic and postnatal lethality, reduced fertility, and decreased cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh C A 5: 77,030,555 (GRCm39) A682S probably benign Het
Acad11 A T 9: 103,941,105 (GRCm39) probably null Het
Ahctf1 A T 1: 179,590,411 (GRCm39) D1287E probably benign Het
Aldh9a1 C A 1: 167,189,119 (GRCm39) L360M probably benign Het
Ank3 A T 10: 69,826,331 (GRCm39) I1667F Het
Atp8b3 A G 10: 80,360,240 (GRCm39) Y944H probably damaging Het
Ccdc30 T C 4: 119,210,369 (GRCm39) D316G probably damaging Het
Ccdc50 T C 16: 27,225,425 (GRCm39) I46T possibly damaging Het
Cfap74 T G 4: 155,547,513 (GRCm39) I1233S unknown Het
Chd9 A G 8: 91,778,325 (GRCm39) M2779V probably damaging Het
Cmya5 A T 13: 93,230,629 (GRCm39) D1486E probably benign Het
Creb3 T C 4: 43,563,117 (GRCm39) V72A not run Het
Cxcl17 C A 7: 25,102,293 (GRCm39) C50F probably damaging Het
Dcaf11 C A 14: 55,806,762 (GRCm39) N528K probably benign Het
Ddx46 T C 13: 55,806,972 (GRCm39) V535A probably benign Het
Det1 A T 7: 78,493,359 (GRCm39) V215D possibly damaging Het
Dnaja3 A G 16: 4,512,328 (GRCm39) N244S probably benign Het
Dnajc13 G T 9: 104,110,891 (GRCm39) P127T probably benign Het
Dnm2 T A 9: 21,392,717 (GRCm39) probably null Het
Fam117a G T 11: 95,262,322 (GRCm39) R142L probably benign Het
Fpr-rs6 T C 17: 20,402,999 (GRCm39) M121V probably benign Het
Gatad1 T C 5: 3,696,867 (GRCm39) T95A probably benign Het
Gdap2 A G 3: 100,099,015 (GRCm39) D369G probably benign Het
Gm12185 A T 11: 48,798,455 (GRCm39) D679E probably benign Het
Gm5519 G C 19: 33,802,428 (GRCm39) G157A probably benign Het
Gmeb2 T A 2: 180,902,181 (GRCm39) H123L probably benign Het
Golgb1 C T 16: 36,734,031 (GRCm39) P1134S probably benign Het
Gsdmc2 G T 15: 63,696,932 (GRCm39) A413D probably damaging Het
Hck C T 2: 152,971,005 (GRCm39) A89V possibly damaging Het
Heatr5b G A 17: 79,103,412 (GRCm39) T1147M probably damaging Het
Hoxb2 A T 11: 96,244,283 (GRCm39) D298V possibly damaging Het
Hrc A G 7: 44,986,658 (GRCm39) E603G probably benign Het
Hsd3b5 C A 3: 98,526,757 (GRCm39) A230S probably damaging Het
Hsh2d A G 8: 72,954,355 (GRCm39) S246G probably benign Het
Ifna4 A C 4: 88,760,309 (GRCm39) Q71P possibly damaging Het
Il4i1 A G 7: 44,489,786 (GRCm39) E517G probably benign Het
Kdm6b A C 11: 69,296,568 (GRCm39) S566R probably damaging Het
Lamc2 T A 1: 152,999,782 (GRCm39) Q1192H probably damaging Het
Map2 T C 1: 66,452,933 (GRCm39) S608P probably benign Het
Marchf9 T C 10: 126,892,468 (GRCm39) E340G probably damaging Het
Mcm3 A G 1: 20,882,238 (GRCm39) L442P probably damaging Het
Mreg A C 1: 72,200,123 (GRCm39) M189R probably benign Het
Myh4 A T 11: 67,136,339 (GRCm39) R406W probably damaging Het
Nol8 A G 13: 49,818,256 (GRCm39) D842G probably benign Het
Nrros T A 16: 31,981,099 (GRCm39) I10F unknown Het
Obscn G A 11: 58,918,263 (GRCm39) P210S Het
Or4f59 T A 2: 111,872,925 (GRCm39) M151L probably benign Het
Or5g29 T C 2: 85,421,406 (GRCm39) I174T possibly damaging Het
Or8b40 A T 9: 38,027,523 (GRCm39) T149S probably benign Het
Or8k38 T C 2: 86,488,070 (GRCm39) H244R probably damaging Het
Orai1 A G 5: 123,167,505 (GRCm39) H226R probably benign Het
Pcdhb18 G T 18: 37,624,790 (GRCm39) V707L probably benign Het
Pex5 A T 6: 124,376,342 (GRCm39) L420Q probably damaging Het
Rab8a A G 8: 72,915,140 (GRCm39) probably benign Het
Rexo4 G A 2: 26,848,505 (GRCm39) H339Y probably benign Het
Rpgrip1l A T 8: 92,027,415 (GRCm39) I208K possibly damaging Het
Sbno1 G A 5: 124,551,279 (GRCm39) P68L probably benign Het
Selenop G T 15: 3,304,340 (GRCm39) C62F probably damaging Het
Slc13a4 A T 6: 35,253,411 (GRCm39) V397D probably damaging Het
Slc4a3 T C 1: 75,533,995 (GRCm39) V1114A probably damaging Het
Stard3nl A T 13: 19,551,923 (GRCm39) S214T probably benign Het
Stra8 T A 6: 34,904,853 (GRCm39) probably null Het
Stx8 T C 11: 67,875,465 (GRCm39) F97L probably benign Het
Thsd7b A G 1: 129,843,487 (GRCm39) probably null Het
Tmem94 T C 11: 115,679,204 (GRCm39) I251T probably benign Het
Top6bl A C 19: 4,695,661 (GRCm39) D530E probably damaging Het
Toporsl A T 4: 52,610,679 (GRCm39) T191S probably damaging Het
Vmn1r53 T A 6: 90,200,625 (GRCm39) E233V probably damaging Het
Wdr49 A T 3: 75,358,214 (GRCm39) L177Q probably damaging Het
Wnt8b T C 19: 44,500,127 (GRCm39) L238P possibly damaging Het
Xirp2 T C 2: 67,347,431 (GRCm39) V3224A probably damaging Het
Zfp583 G T 7: 6,320,009 (GRCm39) N334K possibly damaging Het
Zfp60 T A 7: 27,447,740 (GRCm39) I136N probably benign Het
Zmynd15 G T 11: 70,356,866 (GRCm39) R722L unknown Het
Other mutations in Rif1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Rif1 APN 2 52,011,019 (GRCm39) missense probably damaging 0.96
IGL00711:Rif1 APN 2 52,001,082 (GRCm39) missense probably benign 0.00
IGL00721:Rif1 APN 2 52,009,129 (GRCm39) missense probably damaging 1.00
IGL01085:Rif1 APN 2 51,975,152 (GRCm39) missense possibly damaging 0.71
IGL01093:Rif1 APN 2 51,985,960 (GRCm39) missense probably damaging 1.00
IGL01107:Rif1 APN 2 52,001,315 (GRCm39) missense probably benign 0.00
IGL01138:Rif1 APN 2 52,001,534 (GRCm39) missense probably damaging 1.00
IGL01844:Rif1 APN 2 52,002,555 (GRCm39) missense probably benign 0.07
IGL02441:Rif1 APN 2 51,995,527 (GRCm39) missense probably benign 0.00
IGL02448:Rif1 APN 2 52,006,708 (GRCm39) missense probably damaging 0.99
IGL02563:Rif1 APN 2 51,967,077 (GRCm39) missense probably damaging 1.00
IGL02704:Rif1 APN 2 51,983,588 (GRCm39) missense probably damaging 1.00
IGL02946:Rif1 APN 2 52,000,137 (GRCm39) nonsense probably null
IGL03060:Rif1 APN 2 52,002,149 (GRCm39) missense probably damaging 0.97
IGL03206:Rif1 APN 2 51,993,634 (GRCm39) missense probably damaging 1.00
IGL03263:Rif1 APN 2 51,980,273 (GRCm39) missense probably damaging 0.99
IGL03267:Rif1 APN 2 51,967,000 (GRCm39) missense possibly damaging 0.94
IGL03280:Rif1 APN 2 52,002,611 (GRCm39) missense probably benign 0.32
hifi UTSW 2 52,000,336 (GRCm39) unclassified probably benign
nietzsche UTSW 2 51,967,032 (GRCm39) missense probably benign 0.08
PIT4305001:Rif1 UTSW 2 52,001,970 (GRCm39) missense
R0017:Rif1 UTSW 2 52,006,686 (GRCm39) missense probably benign 0.18
R0017:Rif1 UTSW 2 52,006,686 (GRCm39) missense probably benign 0.18
R0060:Rif1 UTSW 2 52,001,129 (GRCm39) missense probably damaging 1.00
R0060:Rif1 UTSW 2 52,001,129 (GRCm39) missense probably damaging 1.00
R0104:Rif1 UTSW 2 52,000,104 (GRCm39) missense possibly damaging 0.77
R0268:Rif1 UTSW 2 51,980,298 (GRCm39) critical splice donor site probably null
R0276:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0278:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0288:Rif1 UTSW 2 52,000,025 (GRCm39) missense probably damaging 1.00
R0314:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0345:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0346:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0383:Rif1 UTSW 2 51,975,153 (GRCm39) missense probably damaging 0.96
R0384:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0387:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0388:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0456:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0477:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0505:Rif1 UTSW 2 52,000,749 (GRCm39) missense probably damaging 0.99
R0510:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0511:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0512:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0633:Rif1 UTSW 2 52,002,575 (GRCm39) missense probably benign 0.00
R0637:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0638:Rif1 UTSW 2 52,001,600 (GRCm39) missense probably benign 0.12
R0666:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0675:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0707:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0726:Rif1 UTSW 2 52,000,365 (GRCm39) missense possibly damaging 0.52
R0743:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0744:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0938:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0939:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0940:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0941:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0942:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0943:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1006:Rif1 UTSW 2 51,975,041 (GRCm39) missense probably damaging 0.99
R1052:Rif1 UTSW 2 52,001,574 (GRCm39) missense probably benign 0.01
R1061:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1175:Rif1 UTSW 2 51,997,640 (GRCm39) unclassified probably benign
R1183:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1184:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1271:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1332:Rif1 UTSW 2 51,968,326 (GRCm39) missense probably benign 0.06
R1336:Rif1 UTSW 2 51,968,326 (GRCm39) missense probably benign 0.06
R1351:Rif1 UTSW 2 52,001,567 (GRCm39) missense possibly damaging 0.74
R1517:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1527:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1560:Rif1 UTSW 2 52,001,143 (GRCm39) missense probably damaging 1.00
R1563:Rif1 UTSW 2 51,963,235 (GRCm39) missense probably damaging 0.99
R1571:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1625:Rif1 UTSW 2 51,993,652 (GRCm39) missense probably benign 0.25
R1679:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1689:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1731:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1744:Rif1 UTSW 2 52,002,404 (GRCm39) missense possibly damaging 0.56
R1746:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1748:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1831:Rif1 UTSW 2 51,968,507 (GRCm39) nonsense probably null
R1902:Rif1 UTSW 2 52,006,685 (GRCm39) missense possibly damaging 0.93
R1964:Rif1 UTSW 2 51,988,421 (GRCm39) missense probably benign 0.01
R1978:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2000:Rif1 UTSW 2 51,971,310 (GRCm39) missense probably damaging 0.99
R2030:Rif1 UTSW 2 51,982,358 (GRCm39) missense probably damaging 1.00
R2056:Rif1 UTSW 2 51,983,588 (GRCm39) missense probably damaging 1.00
R2106:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2109:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2125:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2126:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2145:Rif1 UTSW 2 52,001,412 (GRCm39) missense possibly damaging 0.63
R2152:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2153:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2213:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2327:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2512:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2513:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2516:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2520:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2905:Rif1 UTSW 2 51,988,516 (GRCm39) missense probably damaging 0.99
R3005:Rif1 UTSW 2 51,972,776 (GRCm39) missense probably damaging 1.00
R3155:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R3156:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R3429:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R3707:Rif1 UTSW 2 51,983,592 (GRCm39) missense probably damaging 1.00
R3907:Rif1 UTSW 2 52,002,557 (GRCm39) missense probably benign 0.03
R3978:Rif1 UTSW 2 52,006,759 (GRCm39) critical splice donor site probably null
R4023:Rif1 UTSW 2 52,011,099 (GRCm39) missense probably benign 0.01
R4052:Rif1 UTSW 2 51,988,483 (GRCm39) nonsense probably null
R4668:Rif1 UTSW 2 52,001,964 (GRCm39) missense probably benign 0.01
R4674:Rif1 UTSW 2 51,996,954 (GRCm39) missense probably null 1.00
R4715:Rif1 UTSW 2 51,963,151 (GRCm39) utr 5 prime probably benign
R4766:Rif1 UTSW 2 51,988,946 (GRCm39) missense probably damaging 1.00
R4783:Rif1 UTSW 2 52,002,759 (GRCm39) missense probably damaging 0.96
R4785:Rif1 UTSW 2 52,002,759 (GRCm39) missense probably damaging 0.96
R4869:Rif1 UTSW 2 51,983,623 (GRCm39) intron probably benign
R4911:Rif1 UTSW 2 52,000,530 (GRCm39) missense probably damaging 0.98
R4951:Rif1 UTSW 2 51,974,998 (GRCm39) splice site probably null
R5044:Rif1 UTSW 2 51,999,940 (GRCm39) missense probably damaging 0.99
R5088:Rif1 UTSW 2 51,982,307 (GRCm39) missense possibly damaging 0.91
R5151:Rif1 UTSW 2 52,010,321 (GRCm39) missense probably damaging 1.00
R5187:Rif1 UTSW 2 51,971,301 (GRCm39) missense probably damaging 1.00
R5222:Rif1 UTSW 2 51,967,032 (GRCm39) missense probably benign 0.08
R5243:Rif1 UTSW 2 52,001,836 (GRCm39) missense possibly damaging 0.86
R5436:Rif1 UTSW 2 52,010,983 (GRCm39) intron probably benign
R5476:Rif1 UTSW 2 51,979,607 (GRCm39) missense probably damaging 1.00
R5496:Rif1 UTSW 2 51,988,928 (GRCm39) missense probably damaging 1.00
R5641:Rif1 UTSW 2 52,011,170 (GRCm39) missense possibly damaging 0.80
R5883:Rif1 UTSW 2 51,995,651 (GRCm39) critical splice donor site probably null
R5987:Rif1 UTSW 2 51,985,856 (GRCm39) missense probably damaging 1.00
R5990:Rif1 UTSW 2 51,985,856 (GRCm39) missense probably damaging 1.00
R5992:Rif1 UTSW 2 51,985,856 (GRCm39) missense probably damaging 1.00
R6019:Rif1 UTSW 2 51,985,856 (GRCm39) missense probably damaging 1.00
R6020:Rif1 UTSW 2 51,985,856 (GRCm39) missense probably damaging 1.00
R6255:Rif1 UTSW 2 51,975,065 (GRCm39) missense probably damaging 1.00
R6342:Rif1 UTSW 2 52,009,168 (GRCm39) missense probably damaging 0.97
R6364:Rif1 UTSW 2 51,997,681 (GRCm39) missense probably damaging 0.97
R6747:Rif1 UTSW 2 51,968,275 (GRCm39) splice site probably null
R6928:Rif1 UTSW 2 51,985,973 (GRCm39) missense probably damaging 1.00
R6954:Rif1 UTSW 2 52,002,703 (GRCm39) missense probably benign 0.00
R7003:Rif1 UTSW 2 51,967,001 (GRCm39) missense probably benign 0.06
R7310:Rif1 UTSW 2 51,995,631 (GRCm39) missense probably benign 0.12
R7549:Rif1 UTSW 2 51,968,519 (GRCm39) missense possibly damaging 0.52
R7603:Rif1 UTSW 2 51,966,187 (GRCm39) missense probably damaging 1.00
R7741:Rif1 UTSW 2 51,975,153 (GRCm39) missense probably damaging 0.96
R7777:Rif1 UTSW 2 52,006,368 (GRCm39) missense probably benign 0.00
R7910:Rif1 UTSW 2 51,968,399 (GRCm39) nonsense probably null
R7962:Rif1 UTSW 2 51,964,288 (GRCm39) missense probably damaging 1.00
R8264:Rif1 UTSW 2 51,980,290 (GRCm39) missense noncoding transcript
R8390:Rif1 UTSW 2 52,000,935 (GRCm39) missense probably damaging 1.00
R8479:Rif1 UTSW 2 52,002,563 (GRCm39) missense possibly damaging 0.52
R8490:Rif1 UTSW 2 52,001,011 (GRCm39) missense probably damaging 0.96
R8762:Rif1 UTSW 2 52,001,742 (GRCm39) missense
R8785:Rif1 UTSW 2 52,000,493 (GRCm39) missense probably benign 0.06
R8890:Rif1 UTSW 2 51,988,875 (GRCm39) missense probably damaging 0.99
R9081:Rif1 UTSW 2 52,000,989 (GRCm39) missense probably damaging 0.99
R9225:Rif1 UTSW 2 52,001,862 (GRCm39) missense probably benign 0.22
R9284:Rif1 UTSW 2 51,998,564 (GRCm39) missense probably benign 0.00
R9300:Rif1 UTSW 2 52,001,151 (GRCm39) missense probably damaging 1.00
R9366:Rif1 UTSW 2 52,010,356 (GRCm39) missense
R9477:Rif1 UTSW 2 52,001,342 (GRCm39) missense probably benign 0.02
R9522:Rif1 UTSW 2 51,971,311 (GRCm39) missense probably damaging 1.00
R9573:Rif1 UTSW 2 52,000,466 (GRCm39) missense probably benign 0.29
R9630:Rif1 UTSW 2 51,979,607 (GRCm39) missense probably damaging 1.00
X0064:Rif1 UTSW 2 51,984,645 (GRCm39) missense probably damaging 0.96
X0064:Rif1 UTSW 2 51,964,327 (GRCm39) missense probably benign 0.00
Z1177:Rif1 UTSW 2 51,978,660 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCTTCTGTGAGACTGGTCATG -3'
(R):5'- AATCTCATCTCCAGAGGCCTG -3'

Sequencing Primer
(F):5'- GAGAACACAGGCTGCTTTTC -3'
(R):5'- ATCTCCAGAGGCCTGTGACC -3'
Posted On 2019-11-12