Incidental Mutation 'R7673:Rif1'
ID592281
Institutional Source Beutler Lab
Gene Symbol Rif1
Ensembl Gene ENSMUSG00000036202
Gene Namereplication timing regulatory factor 1
Synonyms6530403D07Rik, 5730435J01Rik, D2Ertd145e
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7673 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location52072832-52122383 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 52088654 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 369 (V369M)
Ref Sequence ENSEMBL: ENSMUSP00000108313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112693]
Predicted Effect probably damaging
Transcript: ENSMUST00000112693
AA Change: V369M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108313
Gene: ENSMUSG00000036202
AA Change: V369M

DomainStartEndE-ValueType
Pfam:Rif1_N 18 381 1.4e-85 PFAM
low complexity region 432 444 N/A INTRINSIC
low complexity region 586 598 N/A INTRINSIC
low complexity region 1018 1038 N/A INTRINSIC
low complexity region 1180 1205 N/A INTRINSIC
low complexity region 1310 1321 N/A INTRINSIC
low complexity region 1423 1446 N/A INTRINSIC
low complexity region 1576 1586 N/A INTRINSIC
low complexity region 1677 1690 N/A INTRINSIC
low complexity region 1702 1712 N/A INTRINSIC
low complexity region 2176 2195 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that shares homology with the yeast teleomere binding protein, Rap1 interacting factor 1. This protein localizes to aberrant telomeres may be involved in DNA repair. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice homozygous for a gene trap allele exhibit embryonic and postnatal lethality, reduced fertility, and decreased cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh C A 5: 76,882,708 A682S probably benign Het
Ahctf1 A T 1: 179,762,846 D1287E probably benign Het
Aldh9a1 C A 1: 167,361,550 L360M probably benign Het
Ank3 A T 10: 69,990,501 I1667F Het
Atp8b3 A G 10: 80,524,406 Y944H probably damaging Het
Ccdc30 T C 4: 119,353,172 D316G probably damaging Het
Ccdc50 T C 16: 27,406,675 I46T possibly damaging Het
Cfap74 T G 4: 155,463,056 I1233S unknown Het
Chd9 A G 8: 91,051,697 M2779V probably damaging Het
Cmya5 A T 13: 93,094,121 D1486E probably benign Het
Creb3 T C 4: 43,563,117 V72A not run Het
Cxcl17 C A 7: 25,402,868 C50F probably damaging Het
Dcaf11 C A 14: 55,569,305 N528K probably benign Het
Ddx46 T C 13: 55,659,159 V535A probably benign Het
Det1 A T 7: 78,843,611 V215D possibly damaging Het
Dnaja3 A G 16: 4,694,464 N244S probably benign Het
Dnajc13 G T 9: 104,233,692 P127T probably benign Het
Dnm2 T A 9: 21,481,421 probably null Het
Fam117a G T 11: 95,371,496 R142L probably benign Het
Fpr-rs6 T C 17: 20,182,737 M121V probably benign Het
Gatad1 T C 5: 3,646,867 T95A probably benign Het
Gdap2 A G 3: 100,191,699 D369G probably benign Het
Gm12185 A T 11: 48,907,628 D679E probably benign Het
Gm5519 G C 19: 33,825,028 G157A probably benign Het
Gm960 A C 19: 4,645,633 D530E probably damaging Het
Gmeb2 T A 2: 181,260,388 H123L probably benign Het
Golgb1 C T 16: 36,913,669 P1134S probably benign Het
Gsdmc2 G T 15: 63,825,083 A413D probably damaging Het
Hck C T 2: 153,129,085 A89V possibly damaging Het
Heatr5b G A 17: 78,795,983 T1147M probably damaging Het
Hoxb2 A T 11: 96,353,457 D298V possibly damaging Het
Hrc A G 7: 45,337,234 E603G probably benign Het
Hsd3b5 C A 3: 98,619,441 A230S probably damaging Het
Hsh2d A G 8: 72,200,511 S246G probably benign Het
Ifna4 A C 4: 88,842,072 Q71P possibly damaging Het
Il4i1 A G 7: 44,840,362 E517G probably benign Het
Kdm6b A C 11: 69,405,742 S566R probably damaging Het
Lamc2 T A 1: 153,124,036 Q1192H probably damaging Het
Map2 T C 1: 66,413,774 S608P probably benign Het
March9 T C 10: 127,056,599 E340G probably damaging Het
Mcm3 A G 1: 20,812,014 L442P probably damaging Het
Mreg A C 1: 72,160,964 M189R probably benign Het
Myh4 A T 11: 67,245,513 R406W probably damaging Het
Nol8 A G 13: 49,664,780 D842G probably benign Het
Nrros T A 16: 32,162,281 I10F unknown Het
Obscn G A 11: 59,027,437 P210S Het
Olfr1085 T C 2: 86,657,726 H244R probably damaging Het
Olfr1312 T A 2: 112,042,580 M151L probably benign Het
Olfr889 A T 9: 38,116,227 T149S probably benign Het
Olfr998 T C 2: 85,591,062 I174T possibly damaging Het
Orai1 A G 5: 123,029,442 H226R probably benign Het
Pcdhb18 G T 18: 37,491,737 V707L probably benign Het
Pex5 A T 6: 124,399,383 L420Q probably damaging Het
Rab8a A G 8: 72,161,296 probably benign Het
Rexo4 G A 2: 26,958,493 H339Y probably benign Het
Rpgrip1l A T 8: 91,300,787 I208K possibly damaging Het
Sbno1 G A 5: 124,413,216 P68L probably benign Het
Selenop G T 15: 3,274,858 C62F probably damaging Het
Slc13a4 A T 6: 35,276,476 V397D probably damaging Het
Slc4a3 T C 1: 75,557,351 V1114A probably damaging Het
Stard3nl A T 13: 19,367,753 S214T probably benign Het
Stra8 T A 6: 34,927,918 probably null Het
Stx8 T C 11: 67,984,639 F97L probably benign Het
Tmem94 T C 11: 115,788,378 I251T probably benign Het
Toporsl A T 4: 52,610,679 T191S probably damaging Het
Vmn1r53 T A 6: 90,223,643 E233V probably damaging Het
Wdr49 A T 3: 75,450,907 L177Q probably damaging Het
Wnt8b T C 19: 44,511,688 L238P possibly damaging Het
Xirp2 T C 2: 67,517,087 V3224A probably damaging Het
Zfp583 G T 7: 6,317,010 N334K possibly damaging Het
Zfp60 T A 7: 27,748,315 I136N probably benign Het
Zmynd15 G T 11: 70,466,040 R722L unknown Het
Other mutations in Rif1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Rif1 APN 2 52121007 missense probably damaging 0.96
IGL00711:Rif1 APN 2 52111070 missense probably benign 0.00
IGL00721:Rif1 APN 2 52119117 missense probably damaging 1.00
IGL01085:Rif1 APN 2 52085140 missense possibly damaging 0.71
IGL01093:Rif1 APN 2 52095948 missense probably damaging 1.00
IGL01107:Rif1 APN 2 52111303 missense probably benign 0.00
IGL01138:Rif1 APN 2 52111522 missense probably damaging 1.00
IGL01844:Rif1 APN 2 52112543 missense probably benign 0.07
IGL02441:Rif1 APN 2 52105515 missense probably benign 0.00
IGL02448:Rif1 APN 2 52116696 missense probably damaging 0.99
IGL02563:Rif1 APN 2 52077065 missense probably damaging 1.00
IGL02704:Rif1 APN 2 52093576 missense probably damaging 1.00
IGL02946:Rif1 APN 2 52110125 nonsense probably null
IGL03060:Rif1 APN 2 52112137 missense probably damaging 0.97
IGL03206:Rif1 APN 2 52103622 missense probably damaging 1.00
IGL03263:Rif1 APN 2 52090261 missense probably damaging 0.99
IGL03267:Rif1 APN 2 52076988 missense possibly damaging 0.94
IGL03280:Rif1 APN 2 52112599 missense probably benign 0.32
nietzsche UTSW 2 52077020 missense probably benign 0.08
PIT4305001:Rif1 UTSW 2 52111958 missense
R0017:Rif1 UTSW 2 52116674 missense probably benign 0.18
R0017:Rif1 UTSW 2 52116674 missense probably benign 0.18
R0060:Rif1 UTSW 2 52111117 missense probably damaging 1.00
R0060:Rif1 UTSW 2 52111117 missense probably damaging 1.00
R0104:Rif1 UTSW 2 52110092 missense possibly damaging 0.77
R0268:Rif1 UTSW 2 52090286 critical splice donor site probably null
R0276:Rif1 UTSW 2 52110324 unclassified probably benign
R0278:Rif1 UTSW 2 52110324 unclassified probably benign
R0288:Rif1 UTSW 2 52110013 missense probably damaging 1.00
R0314:Rif1 UTSW 2 52110324 unclassified probably benign
R0345:Rif1 UTSW 2 52110324 unclassified probably benign
R0346:Rif1 UTSW 2 52110324 unclassified probably benign
R0383:Rif1 UTSW 2 52085141 missense probably damaging 0.96
R0384:Rif1 UTSW 2 52110324 unclassified probably benign
R0387:Rif1 UTSW 2 52110324 unclassified probably benign
R0388:Rif1 UTSW 2 52110324 unclassified probably benign
R0456:Rif1 UTSW 2 52110324 unclassified probably benign
R0477:Rif1 UTSW 2 52110324 unclassified probably benign
R0505:Rif1 UTSW 2 52110737 missense probably damaging 0.99
R0510:Rif1 UTSW 2 52110324 unclassified probably benign
R0511:Rif1 UTSW 2 52110324 unclassified probably benign
R0512:Rif1 UTSW 2 52110324 unclassified probably benign
R0633:Rif1 UTSW 2 52112563 missense probably benign 0.00
R0637:Rif1 UTSW 2 52110324 unclassified probably benign
R0638:Rif1 UTSW 2 52111588 missense probably benign 0.12
R0666:Rif1 UTSW 2 52110324 unclassified probably benign
R0675:Rif1 UTSW 2 52110324 unclassified probably benign
R0707:Rif1 UTSW 2 52110324 unclassified probably benign
R0726:Rif1 UTSW 2 52110353 missense possibly damaging 0.52
R0743:Rif1 UTSW 2 52110324 unclassified probably benign
R0744:Rif1 UTSW 2 52110324 unclassified probably benign
R0938:Rif1 UTSW 2 52110324 unclassified probably benign
R0939:Rif1 UTSW 2 52110324 unclassified probably benign
R0940:Rif1 UTSW 2 52110324 unclassified probably benign
R0941:Rif1 UTSW 2 52110324 unclassified probably benign
R0942:Rif1 UTSW 2 52110324 unclassified probably benign
R0943:Rif1 UTSW 2 52110324 unclassified probably benign
R1006:Rif1 UTSW 2 52085029 missense probably damaging 0.99
R1052:Rif1 UTSW 2 52111562 missense probably benign 0.01
R1061:Rif1 UTSW 2 52110324 unclassified probably benign
R1175:Rif1 UTSW 2 52107628 unclassified probably benign
R1183:Rif1 UTSW 2 52110324 unclassified probably benign
R1184:Rif1 UTSW 2 52110324 unclassified probably benign
R1271:Rif1 UTSW 2 52110324 unclassified probably benign
R1332:Rif1 UTSW 2 52078314 missense probably benign 0.06
R1336:Rif1 UTSW 2 52078314 missense probably benign 0.06
R1351:Rif1 UTSW 2 52111555 missense possibly damaging 0.74
R1517:Rif1 UTSW 2 52110324 unclassified probably benign
R1527:Rif1 UTSW 2 52110324 unclassified probably benign
R1560:Rif1 UTSW 2 52111131 missense probably damaging 1.00
R1563:Rif1 UTSW 2 52073223 missense probably damaging 0.99
R1571:Rif1 UTSW 2 52110324 unclassified probably benign
R1625:Rif1 UTSW 2 52103640 missense probably benign 0.25
R1679:Rif1 UTSW 2 52110324 unclassified probably benign
R1689:Rif1 UTSW 2 52110324 unclassified probably benign
R1731:Rif1 UTSW 2 52110324 unclassified probably benign
R1744:Rif1 UTSW 2 52112392 missense possibly damaging 0.56
R1746:Rif1 UTSW 2 52110324 unclassified probably benign
R1748:Rif1 UTSW 2 52110324 unclassified probably benign
R1831:Rif1 UTSW 2 52078495 nonsense probably null
R1902:Rif1 UTSW 2 52116673 missense possibly damaging 0.93
R1964:Rif1 UTSW 2 52098409 missense probably benign 0.01
R1978:Rif1 UTSW 2 52110324 unclassified probably benign
R2000:Rif1 UTSW 2 52081298 missense probably damaging 0.99
R2030:Rif1 UTSW 2 52092346 missense probably damaging 1.00
R2056:Rif1 UTSW 2 52093576 missense probably damaging 1.00
R2106:Rif1 UTSW 2 52110324 unclassified probably benign
R2109:Rif1 UTSW 2 52110324 unclassified probably benign
R2125:Rif1 UTSW 2 52110324 unclassified probably benign
R2126:Rif1 UTSW 2 52110324 unclassified probably benign
R2145:Rif1 UTSW 2 52111400 missense possibly damaging 0.63
R2152:Rif1 UTSW 2 52110324 unclassified probably benign
R2153:Rif1 UTSW 2 52110324 unclassified probably benign
R2213:Rif1 UTSW 2 52110324 unclassified probably benign
R2327:Rif1 UTSW 2 52110324 unclassified probably benign
R2512:Rif1 UTSW 2 52110324 unclassified probably benign
R2513:Rif1 UTSW 2 52110324 unclassified probably benign
R2516:Rif1 UTSW 2 52110324 unclassified probably benign
R2520:Rif1 UTSW 2 52110324 unclassified probably benign
R2905:Rif1 UTSW 2 52098504 missense probably damaging 0.99
R3005:Rif1 UTSW 2 52082764 missense probably damaging 1.00
R3155:Rif1 UTSW 2 52110324 unclassified probably benign
R3156:Rif1 UTSW 2 52110324 unclassified probably benign
R3429:Rif1 UTSW 2 52110324 unclassified probably benign
R3707:Rif1 UTSW 2 52093580 missense probably damaging 1.00
R3907:Rif1 UTSW 2 52112545 missense probably benign 0.03
R3978:Rif1 UTSW 2 52116747 critical splice donor site probably null
R4023:Rif1 UTSW 2 52121087 missense probably benign 0.01
R4052:Rif1 UTSW 2 52098471 nonsense probably null
R4668:Rif1 UTSW 2 52111952 missense probably benign 0.01
R4674:Rif1 UTSW 2 52106942 missense probably null 1.00
R4715:Rif1 UTSW 2 52073139 utr 5 prime probably benign
R4766:Rif1 UTSW 2 52098934 missense probably damaging 1.00
R4783:Rif1 UTSW 2 52112747 missense probably damaging 0.96
R4785:Rif1 UTSW 2 52112747 missense probably damaging 0.96
R4869:Rif1 UTSW 2 52093611 intron probably benign
R4911:Rif1 UTSW 2 52110518 missense probably damaging 0.98
R4951:Rif1 UTSW 2 52084986 intron probably null
R5044:Rif1 UTSW 2 52109928 missense probably damaging 0.99
R5088:Rif1 UTSW 2 52092295 missense possibly damaging 0.91
R5151:Rif1 UTSW 2 52120309 missense probably damaging 1.00
R5187:Rif1 UTSW 2 52081289 missense probably damaging 1.00
R5222:Rif1 UTSW 2 52077020 missense probably benign 0.08
R5243:Rif1 UTSW 2 52111824 missense possibly damaging 0.86
R5436:Rif1 UTSW 2 52120971 intron probably benign
R5476:Rif1 UTSW 2 52089595 missense probably damaging 1.00
R5496:Rif1 UTSW 2 52098916 missense probably damaging 1.00
R5641:Rif1 UTSW 2 52121158 missense possibly damaging 0.80
R5883:Rif1 UTSW 2 52105639 critical splice donor site probably null
R5987:Rif1 UTSW 2 52095844 missense probably damaging 1.00
R5990:Rif1 UTSW 2 52095844 missense probably damaging 1.00
R5992:Rif1 UTSW 2 52095844 missense probably damaging 1.00
R6019:Rif1 UTSW 2 52095844 missense probably damaging 1.00
R6020:Rif1 UTSW 2 52095844 missense probably damaging 1.00
R6255:Rif1 UTSW 2 52085053 missense probably damaging 1.00
R6342:Rif1 UTSW 2 52119156 missense probably damaging 0.97
R6364:Rif1 UTSW 2 52107669 missense probably damaging 0.97
R6747:Rif1 UTSW 2 52078263 intron probably null
R6928:Rif1 UTSW 2 52095961 missense probably damaging 1.00
R6954:Rif1 UTSW 2 52112691 missense probably benign 0.00
R7003:Rif1 UTSW 2 52076989 missense probably benign 0.06
R7310:Rif1 UTSW 2 52105619 missense probably benign 0.12
R7549:Rif1 UTSW 2 52078507 missense possibly damaging 0.52
R7603:Rif1 UTSW 2 52076175 missense probably damaging 1.00
R7741:Rif1 UTSW 2 52085141 missense probably damaging 0.96
R7777:Rif1 UTSW 2 52116356 missense probably benign 0.00
X0064:Rif1 UTSW 2 52074315 missense probably benign 0.00
X0064:Rif1 UTSW 2 52094633 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCTCTTCTGTGAGACTGGTCATG -3'
(R):5'- AATCTCATCTCCAGAGGCCTG -3'

Sequencing Primer
(F):5'- GAGAACACAGGCTGCTTTTC -3'
(R):5'- ATCTCCAGAGGCCTGTGACC -3'
Posted On2019-11-12