Incidental Mutation 'R0239:Il4ra'
ID59229
Institutional Source Beutler Lab
Gene Symbol Il4ra
Ensembl Gene ENSMUSG00000030748
Gene Nameinterleukin 4 receptor, alpha
SynonymsIl4r, IL-4 receptor alpha chain, CD124
MMRRC Submission 038477-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R0239 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location125552120-125579474 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 125575199 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145824 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033004] [ENSMUST00000206846]
Predicted Effect probably benign
Transcript: ENSMUST00000033004
SMART Domains Protein: ENSMUSP00000033004
Gene: ENSMUSG00000030748

DomainStartEndE-ValueType
Pfam:IL4Ra_N 28 122 9.9e-39 PFAM
FN3 124 211 3.14e0 SMART
low complexity region 369 385 N/A INTRINSIC
low complexity region 562 574 N/A INTRINSIC
low complexity region 617 630 N/A INTRINSIC
low complexity region 635 647 N/A INTRINSIC
low complexity region 674 683 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205394
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206681
Predicted Effect probably benign
Transcript: ENSMUST00000206846
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.2%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of the interleukin-4 receptor, a type I transmembrane protein that can bind interleukin 4 and interleukin 13 to regulate IgE production. The encoded protein also can bind interleukin 4 to promote differentiation of Th2 cells. A soluble form of the encoded protein can be produced by proteolysis of the membrane-bound protein, and this soluble form can inhibit IL4-mediated cell proliferation and IL5 upregulation by T-cells. Allelic variations in this gene have been associated with atopy, a condition that can manifest itself as allergic rhinitis, sinusitus, asthma, or eczema. Polymorphisms in this gene are also associated with resistance to human immunodeficiency virus type-1 infection. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2012]
PHENOTYPE: Nullizygous mice exhibit reduced T helper 2 cell response to N. brasiliensis infection. Homozygotes for a null allele also display severe susceptibility to S. mansoni infection, enhanced carcinogen-induced intestinal tumour initiation, and altered control of chronic Leishmania major infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra1d C A 2: 131,546,214 V474F probably benign Het
Alg8 A T 7: 97,383,684 probably null Het
Ash1l A G 3: 89,067,222 D2618G possibly damaging Het
Atp6v1c2 C A 12: 17,294,675 probably null Het
Cacna1d A G 14: 30,123,496 V572A probably benign Het
Camta1 A G 4: 151,143,730 W882R probably damaging Het
Cd72 A G 4: 43,453,163 V91A probably benign Het
Cdh12 T C 15: 21,586,407 W771R probably damaging Het
Cdx2 G T 5: 147,303,287 T193K probably damaging Het
Cfap70 A C 14: 20,448,605 S5A probably benign Het
Chmp7 A G 14: 69,720,997 V241A probably damaging Het
Col4a1 C T 8: 11,218,780 probably benign Het
D3Ertd751e A G 3: 41,753,878 Y150C probably damaging Het
Depdc5 T C 5: 32,943,240 S832P probably damaging Het
Dnhd1 A G 7: 105,721,531 S4673G probably benign Het
Dock4 G T 12: 40,737,540 S818I probably damaging Het
Dysf C T 6: 84,064,479 Q156* probably null Het
Espnl T C 1: 91,322,287 V52A probably damaging Het
Flcn T C 11: 59,801,076 N249S probably benign Het
Gemin6 C A 17: 80,225,710 A24D probably damaging Het
Gm5773 A G 3: 93,774,032 H337R probably benign Het
Gm9733 A G 3: 15,296,601 L163P probably damaging Het
Greb1l C T 18: 10,458,567 probably benign Het
Hal T C 10: 93,503,482 S478P possibly damaging Het
Hectd1 T A 12: 51,769,318 M1324L possibly damaging Het
Hyal5 T A 6: 24,876,344 L72Q probably damaging Het
Ift140 C A 17: 25,045,523 C557* probably null Het
Ikbkap C A 4: 56,784,596 V466L probably benign Het
Ipo9 A G 1: 135,404,336 probably benign Het
Kbtbd3 G T 9: 4,330,144 V173L possibly damaging Het
Kif14 A G 1: 136,527,393 E1551G probably damaging Het
Klc1 A G 12: 111,785,324 probably benign Het
Krt17 G A 11: 100,260,878 R30* probably null Het
Lamb3 A T 1: 193,321,053 D100V probably damaging Het
Lrmp G A 6: 145,171,978 probably benign Het
Map2 A G 1: 66,416,106 D1385G probably damaging Het
Mettl25 C T 10: 105,826,525 V195I probably damaging Het
Mfsd7a G T 5: 108,444,016 probably benign Het
Micu2 G A 14: 57,917,378 probably benign Het
Mrrf T C 2: 36,177,281 probably benign Het
Myh8 A G 11: 67,301,692 T1466A probably benign Het
Myo3b T A 2: 70,105,425 C61S probably benign Het
Nacc2 T G 2: 26,062,261 N361T probably damaging Het
Nf1 A T 11: 79,418,574 K438M possibly damaging Het
Nipal4 A G 11: 46,150,441 V309A possibly damaging Het
Nomo1 T C 7: 46,079,594 probably null Het
Nubp2 T C 17: 24,884,471 E144G probably damaging Het
Nwd2 A T 5: 63,800,124 I266F probably benign Het
Olfr1126 T C 2: 87,458,037 F291L probably benign Het
Olfr593 G A 7: 103,212,726 V289M possibly damaging Het
Olfr694 A G 7: 106,689,255 Y159H probably benign Het
Orc1 T C 4: 108,595,646 probably null Het
Otogl T A 10: 107,806,696 N1291I probably damaging Het
Pah C T 10: 87,567,281 P173S possibly damaging Het
Pga5 A G 19: 10,669,453 Y305H probably damaging Het
Plekha4 A G 7: 45,532,358 H62R probably damaging Het
Plxnd1 G T 6: 115,968,793 D906E probably benign Het
Ppfia4 T C 1: 134,329,189 E98G possibly damaging Het
Ptk2 A T 15: 73,343,283 probably null Het
Pzp C T 6: 128,489,156 probably benign Het
Raet1c C A 10: 22,180,862 H112Q possibly damaging Het
Scai T A 2: 39,075,042 I597F probably benign Het
Scgb1b2 T A 7: 31,291,730 probably benign Het
Sec31b G A 19: 44,525,469 probably benign Het
Slc35c2 C T 2: 165,280,837 G176S probably damaging Het
Slc35f4 A T 14: 49,304,256 I347N possibly damaging Het
Slc52a3 T C 2: 152,008,156 *461Q probably null Het
Slc6a1 G A 6: 114,302,800 V142I probably benign Het
Tbc1d31 C A 15: 57,940,753 T388N probably benign Het
Tmem131 T C 1: 36,828,050 probably benign Het
Tmem63c T C 12: 87,075,639 W404R probably damaging Het
Tmem79 A G 3: 88,333,321 S107P probably benign Het
Trip11 C T 12: 101,884,728 E741K probably damaging Het
Trpm5 G T 7: 143,082,958 T414N probably damaging Het
Tsnaxip1 T A 8: 105,844,488 I660N possibly damaging Het
Ube2q2 T C 9: 55,163,007 S78P probably damaging Het
Vac14 A T 8: 110,635,375 probably null Het
Vps51 G T 19: 6,071,437 S185* probably null Het
Zfp11 C T 5: 129,658,238 G53E possibly damaging Het
Zfp532 A T 18: 65,682,985 I810F possibly damaging Het
Zfp599 C T 9: 22,249,759 C370Y probably damaging Het
Other mutations in Il4ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00940:Il4ra APN 7 125569175 critical splice donor site probably null
IGL01067:Il4ra APN 7 125575161 missense probably benign 0.09
IGL01107:Il4ra APN 7 125575914 missense possibly damaging 0.88
IGL02224:Il4ra APN 7 125570099 splice site probably benign
IGL02249:Il4ra APN 7 125567224 missense probably benign 0.01
IGL02383:Il4ra APN 7 125571504 missense probably benign 0.06
IGL02614:Il4ra APN 7 125575790 nonsense probably null
IGL02879:Il4ra APN 7 125576897 missense possibly damaging 0.88
Haile UTSW 7 125574717 critical splice donor site probably null
Lowe UTSW 7 125567221 missense probably damaging 1.00
IGL02991:Il4ra UTSW 7 125575661 missense possibly damaging 0.70
PIT4418001:Il4ra UTSW 7 125576338 missense probably benign 0.01
R0066:Il4ra UTSW 7 125576231 missense possibly damaging 0.80
R0127:Il4ra UTSW 7 125569070 missense probably damaging 1.00
R0148:Il4ra UTSW 7 125575537 missense probably damaging 1.00
R0238:Il4ra UTSW 7 125575199 splice site probably benign
R0884:Il4ra UTSW 7 125574663 missense probably damaging 1.00
R1102:Il4ra UTSW 7 125574717 critical splice donor site probably null
R1622:Il4ra UTSW 7 125570053 missense possibly damaging 0.87
R1773:Il4ra UTSW 7 125567182 missense possibly damaging 0.94
R4510:Il4ra UTSW 7 125576108 missense possibly damaging 0.63
R4511:Il4ra UTSW 7 125576108 missense possibly damaging 0.63
R4612:Il4ra UTSW 7 125576083 missense probably benign 0.14
R5865:Il4ra UTSW 7 125575176 missense probably benign 0.00
R5996:Il4ra UTSW 7 125567221 missense probably damaging 1.00
R6057:Il4ra UTSW 7 125571563 missense probably damaging 1.00
R6246:Il4ra UTSW 7 125576405 missense probably benign 0.00
R7218:Il4ra UTSW 7 125575778 missense probably benign 0.01
R7624:Il4ra UTSW 7 125569108 missense probably damaging 1.00
R7904:Il4ra UTSW 7 125565673 missense probably benign 0.05
R7987:Il4ra UTSW 7 125565673 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GGCATGGTTGCTGTCTGTGAAAAC -3'
(R):5'- CCCACACGGAATCACCCTGTATTG -3'

Sequencing Primer
(F):5'- CTGTGAAAACACTGAGCCTTCTG -3'
(R):5'- AAGGGGAATTGATTGCCACC -3'
Posted On2013-07-11