Incidental Mutation 'R7673:Sbno1'
ID 592299
Institutional Source Beutler Lab
Gene Symbol Sbno1
Ensembl Gene ENSMUSG00000038095
Gene Name strawberry notch 1
Synonyms 9330180L10Rik, sno
MMRRC Submission 045743-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7673 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 124506765-124564059 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 124551279 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 68 (P68L)
Ref Sequence ENSEMBL: ENSMUSP00000142481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065263] [ENSMUST00000168651] [ENSMUST00000196329] [ENSMUST00000196644] [ENSMUST00000196711] [ENSMUST00000197777] [ENSMUST00000198420] [ENSMUST00000199808] [ENSMUST00000199004] [ENSMUST00000200474]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000065263
AA Change: P68L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000066808
Gene: ENSMUSG00000038095
AA Change: P68L

DomainStartEndE-ValueType
low complexity region 217 234 N/A INTRINSIC
Pfam:AAA_34 254 559 3.6e-144 PFAM
Pfam:ResIII 287 478 2.7e-8 PFAM
low complexity region 633 649 N/A INTRINSIC
low complexity region 727 748 N/A INTRINSIC
low complexity region 779 797 N/A INTRINSIC
low complexity region 815 838 N/A INTRINSIC
coiled coil region 839 868 N/A INTRINSIC
Pfam:Helicase_C_4 870 1146 3.6e-126 PFAM
low complexity region 1365 1384 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168651
AA Change: P68L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130860
Gene: ENSMUSG00000038095
AA Change: P68L

DomainStartEndE-ValueType
low complexity region 217 234 N/A INTRINSIC
Pfam:AAA_34 254 559 3.6e-144 PFAM
Pfam:ResIII 287 478 2.7e-8 PFAM
low complexity region 633 649 N/A INTRINSIC
low complexity region 727 748 N/A INTRINSIC
low complexity region 779 797 N/A INTRINSIC
low complexity region 815 838 N/A INTRINSIC
coiled coil region 839 868 N/A INTRINSIC
Pfam:Helicase_C_4 870 1146 3.6e-126 PFAM
low complexity region 1365 1384 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196329
SMART Domains Protein: ENSMUSP00000143084
Gene: ENSMUSG00000038095

DomainStartEndE-ValueType
low complexity region 35 51 N/A INTRINSIC
low complexity region 182 199 N/A INTRINSIC
Pfam:AAA_34 217 525 1.4e-139 PFAM
Pfam:ResIII 254 441 2.4e-8 PFAM
low complexity region 598 614 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196644
AA Change: P68L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142827
Gene: ENSMUSG00000038095
AA Change: P68L

DomainStartEndE-ValueType
low complexity region 217 234 N/A INTRINSIC
Pfam:AAA_34 252 560 4.3e-136 PFAM
Pfam:ResIII 289 476 1.8e-6 PFAM
low complexity region 633 649 N/A INTRINSIC
low complexity region 727 748 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196711
SMART Domains Protein: ENSMUSP00000142980
Gene: ENSMUSG00000038095

DomainStartEndE-ValueType
low complexity region 35 51 N/A INTRINSIC
low complexity region 182 199 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197777
AA Change: P68L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000198420
SMART Domains Protein: ENSMUSP00000142416
Gene: ENSMUSG00000038095

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199808
AA Change: P68L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142481
Gene: ENSMUSG00000038095
AA Change: P68L

DomainStartEndE-ValueType
low complexity region 217 234 N/A INTRINSIC
Pfam:AAA_34 252 560 6e-139 PFAM
Pfam:ResIII 289 476 1.3e-7 PFAM
low complexity region 633 649 N/A INTRINSIC
low complexity region 727 748 N/A INTRINSIC
low complexity region 779 797 N/A INTRINSIC
low complexity region 815 838 N/A INTRINSIC
coiled coil region 839 868 N/A INTRINSIC
Pfam:Helicase_C_4 870 1146 4.6e-120 PFAM
low complexity region 1365 1384 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199004
AA Change: P68L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000143314
Gene: ENSMUSG00000038095
AA Change: P68L

DomainStartEndE-ValueType
low complexity region 217 234 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200474
SMART Domains Protein: ENSMUSP00000143516
Gene: ENSMUSG00000038095

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 181 198 N/A INTRINSIC
Pfam:AAA_34 218 523 2.3e-141 PFAM
Pfam:ResIII 251 442 3.3e-7 PFAM
low complexity region 597 613 N/A INTRINSIC
low complexity region 691 712 N/A INTRINSIC
low complexity region 743 755 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh C A 5: 77,030,555 (GRCm39) A682S probably benign Het
Acad11 A T 9: 103,941,105 (GRCm39) probably null Het
Ahctf1 A T 1: 179,590,411 (GRCm39) D1287E probably benign Het
Aldh9a1 C A 1: 167,189,119 (GRCm39) L360M probably benign Het
Ank3 A T 10: 69,826,331 (GRCm39) I1667F Het
Atp8b3 A G 10: 80,360,240 (GRCm39) Y944H probably damaging Het
Ccdc30 T C 4: 119,210,369 (GRCm39) D316G probably damaging Het
Ccdc50 T C 16: 27,225,425 (GRCm39) I46T possibly damaging Het
Cfap74 T G 4: 155,547,513 (GRCm39) I1233S unknown Het
Chd9 A G 8: 91,778,325 (GRCm39) M2779V probably damaging Het
Cmya5 A T 13: 93,230,629 (GRCm39) D1486E probably benign Het
Creb3 T C 4: 43,563,117 (GRCm39) V72A not run Het
Cxcl17 C A 7: 25,102,293 (GRCm39) C50F probably damaging Het
Dcaf11 C A 14: 55,806,762 (GRCm39) N528K probably benign Het
Ddx46 T C 13: 55,806,972 (GRCm39) V535A probably benign Het
Det1 A T 7: 78,493,359 (GRCm39) V215D possibly damaging Het
Dnaja3 A G 16: 4,512,328 (GRCm39) N244S probably benign Het
Dnajc13 G T 9: 104,110,891 (GRCm39) P127T probably benign Het
Dnm2 T A 9: 21,392,717 (GRCm39) probably null Het
Fam117a G T 11: 95,262,322 (GRCm39) R142L probably benign Het
Fpr-rs6 T C 17: 20,402,999 (GRCm39) M121V probably benign Het
Gatad1 T C 5: 3,696,867 (GRCm39) T95A probably benign Het
Gdap2 A G 3: 100,099,015 (GRCm39) D369G probably benign Het
Gm12185 A T 11: 48,798,455 (GRCm39) D679E probably benign Het
Gm5519 G C 19: 33,802,428 (GRCm39) G157A probably benign Het
Gmeb2 T A 2: 180,902,181 (GRCm39) H123L probably benign Het
Golgb1 C T 16: 36,734,031 (GRCm39) P1134S probably benign Het
Gsdmc2 G T 15: 63,696,932 (GRCm39) A413D probably damaging Het
Hck C T 2: 152,971,005 (GRCm39) A89V possibly damaging Het
Heatr5b G A 17: 79,103,412 (GRCm39) T1147M probably damaging Het
Hoxb2 A T 11: 96,244,283 (GRCm39) D298V possibly damaging Het
Hrc A G 7: 44,986,658 (GRCm39) E603G probably benign Het
Hsd3b5 C A 3: 98,526,757 (GRCm39) A230S probably damaging Het
Hsh2d A G 8: 72,954,355 (GRCm39) S246G probably benign Het
Ifna4 A C 4: 88,760,309 (GRCm39) Q71P possibly damaging Het
Il4i1 A G 7: 44,489,786 (GRCm39) E517G probably benign Het
Kdm6b A C 11: 69,296,568 (GRCm39) S566R probably damaging Het
Lamc2 T A 1: 152,999,782 (GRCm39) Q1192H probably damaging Het
Map2 T C 1: 66,452,933 (GRCm39) S608P probably benign Het
Marchf9 T C 10: 126,892,468 (GRCm39) E340G probably damaging Het
Mcm3 A G 1: 20,882,238 (GRCm39) L442P probably damaging Het
Mreg A C 1: 72,200,123 (GRCm39) M189R probably benign Het
Myh4 A T 11: 67,136,339 (GRCm39) R406W probably damaging Het
Nol8 A G 13: 49,818,256 (GRCm39) D842G probably benign Het
Nrros T A 16: 31,981,099 (GRCm39) I10F unknown Het
Obscn G A 11: 58,918,263 (GRCm39) P210S Het
Or4f59 T A 2: 111,872,925 (GRCm39) M151L probably benign Het
Or5g29 T C 2: 85,421,406 (GRCm39) I174T possibly damaging Het
Or8b40 A T 9: 38,027,523 (GRCm39) T149S probably benign Het
Or8k38 T C 2: 86,488,070 (GRCm39) H244R probably damaging Het
Orai1 A G 5: 123,167,505 (GRCm39) H226R probably benign Het
Pcdhb18 G T 18: 37,624,790 (GRCm39) V707L probably benign Het
Pex5 A T 6: 124,376,342 (GRCm39) L420Q probably damaging Het
Rab8a A G 8: 72,915,140 (GRCm39) probably benign Het
Rexo4 G A 2: 26,848,505 (GRCm39) H339Y probably benign Het
Rif1 G A 2: 51,978,666 (GRCm39) V369M probably damaging Het
Rpgrip1l A T 8: 92,027,415 (GRCm39) I208K possibly damaging Het
Selenop G T 15: 3,304,340 (GRCm39) C62F probably damaging Het
Slc13a4 A T 6: 35,253,411 (GRCm39) V397D probably damaging Het
Slc4a3 T C 1: 75,533,995 (GRCm39) V1114A probably damaging Het
Stard3nl A T 13: 19,551,923 (GRCm39) S214T probably benign Het
Stra8 T A 6: 34,904,853 (GRCm39) probably null Het
Stx8 T C 11: 67,875,465 (GRCm39) F97L probably benign Het
Thsd7b A G 1: 129,843,487 (GRCm39) probably null Het
Tmem94 T C 11: 115,679,204 (GRCm39) I251T probably benign Het
Top6bl A C 19: 4,695,661 (GRCm39) D530E probably damaging Het
Toporsl A T 4: 52,610,679 (GRCm39) T191S probably damaging Het
Vmn1r53 T A 6: 90,200,625 (GRCm39) E233V probably damaging Het
Wdr49 A T 3: 75,358,214 (GRCm39) L177Q probably damaging Het
Wnt8b T C 19: 44,500,127 (GRCm39) L238P possibly damaging Het
Xirp2 T C 2: 67,347,431 (GRCm39) V3224A probably damaging Het
Zfp583 G T 7: 6,320,009 (GRCm39) N334K possibly damaging Het
Zfp60 T A 7: 27,447,740 (GRCm39) I136N probably benign Het
Zmynd15 G T 11: 70,356,866 (GRCm39) R722L unknown Het
Other mutations in Sbno1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00563:Sbno1 APN 5 124,540,268 (GRCm39) missense probably damaging 1.00
IGL01154:Sbno1 APN 5 124,548,312 (GRCm39) missense probably damaging 1.00
IGL01309:Sbno1 APN 5 124,519,769 (GRCm39) missense probably benign 0.41
IGL01330:Sbno1 APN 5 124,530,042 (GRCm39) missense probably damaging 1.00
IGL01541:Sbno1 APN 5 124,516,618 (GRCm39) splice site probably benign
IGL01800:Sbno1 APN 5 124,519,568 (GRCm39) splice site probably benign
IGL01987:Sbno1 APN 5 124,542,282 (GRCm39) missense probably damaging 1.00
IGL02178:Sbno1 APN 5 124,538,258 (GRCm39) splice site probably null
IGL02544:Sbno1 APN 5 124,542,046 (GRCm39) missense probably damaging 0.99
IGL02572:Sbno1 APN 5 124,519,740 (GRCm39) splice site probably benign
IGL02592:Sbno1 APN 5 124,538,872 (GRCm39) missense probably damaging 1.00
IGL03033:Sbno1 APN 5 124,514,213 (GRCm39) missense probably damaging 0.97
IGL03089:Sbno1 APN 5 124,525,374 (GRCm39) splice site probably benign
IGL03131:Sbno1 APN 5 124,526,668 (GRCm39) missense probably damaging 1.00
Decrement UTSW 5 124,538,910 (GRCm39) missense probably damaging 1.00
R0200:Sbno1 UTSW 5 124,522,604 (GRCm39) missense probably damaging 1.00
R0217:Sbno1 UTSW 5 124,542,387 (GRCm39) critical splice acceptor site probably null
R0233:Sbno1 UTSW 5 124,514,289 (GRCm39) missense probably damaging 1.00
R0233:Sbno1 UTSW 5 124,514,289 (GRCm39) missense probably damaging 1.00
R0334:Sbno1 UTSW 5 124,524,931 (GRCm39) missense possibly damaging 0.79
R0401:Sbno1 UTSW 5 124,548,348 (GRCm39) missense probably damaging 0.96
R0608:Sbno1 UTSW 5 124,522,604 (GRCm39) missense probably damaging 1.00
R0615:Sbno1 UTSW 5 124,548,202 (GRCm39) missense probably damaging 1.00
R0653:Sbno1 UTSW 5 124,524,955 (GRCm39) missense possibly damaging 0.79
R0655:Sbno1 UTSW 5 124,514,212 (GRCm39) missense possibly damaging 0.95
R1037:Sbno1 UTSW 5 124,531,975 (GRCm39) missense possibly damaging 0.92
R1439:Sbno1 UTSW 5 124,522,523 (GRCm39) splice site probably benign
R1522:Sbno1 UTSW 5 124,530,675 (GRCm39) missense probably damaging 1.00
R1590:Sbno1 UTSW 5 124,522,567 (GRCm39) missense possibly damaging 0.55
R1618:Sbno1 UTSW 5 124,542,279 (GRCm39) missense probably damaging 1.00
R1671:Sbno1 UTSW 5 124,530,130 (GRCm39) splice site probably null
R1779:Sbno1 UTSW 5 124,526,580 (GRCm39) unclassified probably benign
R2103:Sbno1 UTSW 5 124,532,000 (GRCm39) missense probably damaging 0.98
R2136:Sbno1 UTSW 5 124,525,597 (GRCm39) splice site probably null
R2149:Sbno1 UTSW 5 124,540,182 (GRCm39) splice site probably null
R2153:Sbno1 UTSW 5 124,516,606 (GRCm39) missense probably benign
R2154:Sbno1 UTSW 5 124,516,574 (GRCm39) missense probably benign
R2231:Sbno1 UTSW 5 124,543,767 (GRCm39) missense probably damaging 1.00
R2879:Sbno1 UTSW 5 124,526,635 (GRCm39) missense probably damaging 1.00
R3004:Sbno1 UTSW 5 124,519,771 (GRCm39) missense probably damaging 0.96
R3922:Sbno1 UTSW 5 124,519,993 (GRCm39) missense probably damaging 1.00
R4061:Sbno1 UTSW 5 124,526,635 (GRCm39) missense probably damaging 1.00
R4096:Sbno1 UTSW 5 124,529,983 (GRCm39) critical splice donor site probably null
R4612:Sbno1 UTSW 5 124,542,087 (GRCm39) missense probably damaging 1.00
R4879:Sbno1 UTSW 5 124,542,087 (GRCm39) missense probably damaging 1.00
R4937:Sbno1 UTSW 5 124,512,672 (GRCm39) missense possibly damaging 0.93
R4990:Sbno1 UTSW 5 124,538,228 (GRCm39) missense probably damaging 1.00
R5341:Sbno1 UTSW 5 124,546,538 (GRCm39) critical splice donor site probably null
R5365:Sbno1 UTSW 5 124,519,929 (GRCm39) frame shift probably null
R5399:Sbno1 UTSW 5 124,530,804 (GRCm39) missense probably benign 0.09
R5704:Sbno1 UTSW 5 124,533,956 (GRCm39) critical splice donor site probably null
R5898:Sbno1 UTSW 5 124,524,854 (GRCm39) intron probably benign
R6136:Sbno1 UTSW 5 124,516,554 (GRCm39) missense probably benign 0.41
R6154:Sbno1 UTSW 5 124,516,542 (GRCm39) missense possibly damaging 0.94
R6412:Sbno1 UTSW 5 124,530,777 (GRCm39) missense probably damaging 0.99
R6414:Sbno1 UTSW 5 124,533,994 (GRCm39) missense probably benign 0.28
R6454:Sbno1 UTSW 5 124,538,910 (GRCm39) missense probably damaging 1.00
R7085:Sbno1 UTSW 5 124,519,783 (GRCm39) missense possibly damaging 0.83
R7176:Sbno1 UTSW 5 124,530,944 (GRCm39) missense probably benign 0.21
R7219:Sbno1 UTSW 5 124,543,722 (GRCm39) missense probably benign 0.00
R7535:Sbno1 UTSW 5 124,551,342 (GRCm39) missense possibly damaging 0.48
R7692:Sbno1 UTSW 5 124,543,709 (GRCm39) missense probably benign 0.35
R7745:Sbno1 UTSW 5 124,530,962 (GRCm39) missense probably benign 0.00
R7762:Sbno1 UTSW 5 124,512,729 (GRCm39) missense probably benign 0.19
R8012:Sbno1 UTSW 5 124,522,565 (GRCm39) missense probably benign 0.43
R8142:Sbno1 UTSW 5 124,546,608 (GRCm39) missense probably benign
R8164:Sbno1 UTSW 5 124,512,684 (GRCm39) missense probably benign 0.13
R8259:Sbno1 UTSW 5 124,519,759 (GRCm39) missense probably damaging 0.99
R8289:Sbno1 UTSW 5 124,542,068 (GRCm39) missense probably damaging 1.00
R8717:Sbno1 UTSW 5 124,512,618 (GRCm39) missense possibly damaging 0.85
R9045:Sbno1 UTSW 5 124,543,720 (GRCm39) missense probably benign 0.14
R9149:Sbno1 UTSW 5 124,519,762 (GRCm39) missense probably benign 0.01
R9529:Sbno1 UTSW 5 124,517,413 (GRCm39) nonsense probably null
Z1088:Sbno1 UTSW 5 124,542,367 (GRCm39) missense probably damaging 0.98
Z1088:Sbno1 UTSW 5 124,532,021 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GCACTCAACCATGAAAGAAGTG -3'
(R):5'- ATGCTGATCAAGTTTAGTCTGTTAC -3'

Sequencing Primer
(F):5'- CTCAACCATGAAAGAAGTGAGATAAC -3'
(R):5'- TCAAGGATTCTGCAGGCTAC -3'
Posted On 2019-11-12