Incidental Mutation 'R7673:Atp8b3'
ID 592318
Institutional Source Beutler Lab
Gene Symbol Atp8b3
Ensembl Gene ENSMUSG00000003341
Gene Name ATPase, class I, type 8B, member 3
Synonyms 1700042F02Rik, 1700056N23Rik, SAPLT
MMRRC Submission 045743-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.083) question?
Stock # R7673 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 80355418-80374958 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 80360240 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 944 (Y944H)
Ref Sequence ENSEMBL: ENSMUSP00000020383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020383] [ENSMUST00000220326]
AlphaFold Q6UQ17
Predicted Effect probably damaging
Transcript: ENSMUST00000020383
AA Change: Y944H

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000020383
Gene: ENSMUSG00000003341
AA Change: Y944H

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 20 97 9.3e-29 PFAM
Pfam:E1-E2_ATPase 121 367 2.2e-10 PFAM
Pfam:HAD 404 866 3.7e-17 PFAM
Pfam:Cation_ATPase 481 580 8.3e-12 PFAM
Pfam:PhoLip_ATPase_C 883 1135 4.2e-61 PFAM
low complexity region 1140 1153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220326
AA Change: V857A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to the other. This gene encodes member 3 of phospholipid-transporting ATPase 8B; other members of this protein family are located on chromosomes 1, 15 and 18. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Litters sired by homozygous mutant mice are smaller than those sired by wild-type males. While sperm morphology and motility is intact in null sperm, fertilization rates are reduced due to impaired sperm-egg interactions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh C A 5: 77,030,555 (GRCm39) A682S probably benign Het
Acad11 A T 9: 103,941,105 (GRCm39) probably null Het
Ahctf1 A T 1: 179,590,411 (GRCm39) D1287E probably benign Het
Aldh9a1 C A 1: 167,189,119 (GRCm39) L360M probably benign Het
Ank3 A T 10: 69,826,331 (GRCm39) I1667F Het
Ccdc30 T C 4: 119,210,369 (GRCm39) D316G probably damaging Het
Ccdc50 T C 16: 27,225,425 (GRCm39) I46T possibly damaging Het
Cfap74 T G 4: 155,547,513 (GRCm39) I1233S unknown Het
Chd9 A G 8: 91,778,325 (GRCm39) M2779V probably damaging Het
Cmya5 A T 13: 93,230,629 (GRCm39) D1486E probably benign Het
Creb3 T C 4: 43,563,117 (GRCm39) V72A not run Het
Cxcl17 C A 7: 25,102,293 (GRCm39) C50F probably damaging Het
Dcaf11 C A 14: 55,806,762 (GRCm39) N528K probably benign Het
Ddx46 T C 13: 55,806,972 (GRCm39) V535A probably benign Het
Det1 A T 7: 78,493,359 (GRCm39) V215D possibly damaging Het
Dnaja3 A G 16: 4,512,328 (GRCm39) N244S probably benign Het
Dnajc13 G T 9: 104,110,891 (GRCm39) P127T probably benign Het
Dnm2 T A 9: 21,392,717 (GRCm39) probably null Het
Fam117a G T 11: 95,262,322 (GRCm39) R142L probably benign Het
Fpr-rs6 T C 17: 20,402,999 (GRCm39) M121V probably benign Het
Gatad1 T C 5: 3,696,867 (GRCm39) T95A probably benign Het
Gdap2 A G 3: 100,099,015 (GRCm39) D369G probably benign Het
Gm12185 A T 11: 48,798,455 (GRCm39) D679E probably benign Het
Gm5519 G C 19: 33,802,428 (GRCm39) G157A probably benign Het
Gmeb2 T A 2: 180,902,181 (GRCm39) H123L probably benign Het
Golgb1 C T 16: 36,734,031 (GRCm39) P1134S probably benign Het
Gsdmc2 G T 15: 63,696,932 (GRCm39) A413D probably damaging Het
Hck C T 2: 152,971,005 (GRCm39) A89V possibly damaging Het
Heatr5b G A 17: 79,103,412 (GRCm39) T1147M probably damaging Het
Hoxb2 A T 11: 96,244,283 (GRCm39) D298V possibly damaging Het
Hrc A G 7: 44,986,658 (GRCm39) E603G probably benign Het
Hsd3b5 C A 3: 98,526,757 (GRCm39) A230S probably damaging Het
Hsh2d A G 8: 72,954,355 (GRCm39) S246G probably benign Het
Ifna4 A C 4: 88,760,309 (GRCm39) Q71P possibly damaging Het
Il4i1 A G 7: 44,489,786 (GRCm39) E517G probably benign Het
Kdm6b A C 11: 69,296,568 (GRCm39) S566R probably damaging Het
Lamc2 T A 1: 152,999,782 (GRCm39) Q1192H probably damaging Het
Map2 T C 1: 66,452,933 (GRCm39) S608P probably benign Het
Marchf9 T C 10: 126,892,468 (GRCm39) E340G probably damaging Het
Mcm3 A G 1: 20,882,238 (GRCm39) L442P probably damaging Het
Mreg A C 1: 72,200,123 (GRCm39) M189R probably benign Het
Myh4 A T 11: 67,136,339 (GRCm39) R406W probably damaging Het
Nol8 A G 13: 49,818,256 (GRCm39) D842G probably benign Het
Nrros T A 16: 31,981,099 (GRCm39) I10F unknown Het
Obscn G A 11: 58,918,263 (GRCm39) P210S Het
Or4f59 T A 2: 111,872,925 (GRCm39) M151L probably benign Het
Or5g29 T C 2: 85,421,406 (GRCm39) I174T possibly damaging Het
Or8b40 A T 9: 38,027,523 (GRCm39) T149S probably benign Het
Or8k38 T C 2: 86,488,070 (GRCm39) H244R probably damaging Het
Orai1 A G 5: 123,167,505 (GRCm39) H226R probably benign Het
Pcdhb18 G T 18: 37,624,790 (GRCm39) V707L probably benign Het
Pex5 A T 6: 124,376,342 (GRCm39) L420Q probably damaging Het
Rab8a A G 8: 72,915,140 (GRCm39) probably benign Het
Rexo4 G A 2: 26,848,505 (GRCm39) H339Y probably benign Het
Rif1 G A 2: 51,978,666 (GRCm39) V369M probably damaging Het
Rpgrip1l A T 8: 92,027,415 (GRCm39) I208K possibly damaging Het
Sbno1 G A 5: 124,551,279 (GRCm39) P68L probably benign Het
Selenop G T 15: 3,304,340 (GRCm39) C62F probably damaging Het
Slc13a4 A T 6: 35,253,411 (GRCm39) V397D probably damaging Het
Slc4a3 T C 1: 75,533,995 (GRCm39) V1114A probably damaging Het
Stard3nl A T 13: 19,551,923 (GRCm39) S214T probably benign Het
Stra8 T A 6: 34,904,853 (GRCm39) probably null Het
Stx8 T C 11: 67,875,465 (GRCm39) F97L probably benign Het
Thsd7b A G 1: 129,843,487 (GRCm39) probably null Het
Tmem94 T C 11: 115,679,204 (GRCm39) I251T probably benign Het
Top6bl A C 19: 4,695,661 (GRCm39) D530E probably damaging Het
Toporsl A T 4: 52,610,679 (GRCm39) T191S probably damaging Het
Vmn1r53 T A 6: 90,200,625 (GRCm39) E233V probably damaging Het
Wdr49 A T 3: 75,358,214 (GRCm39) L177Q probably damaging Het
Wnt8b T C 19: 44,500,127 (GRCm39) L238P possibly damaging Het
Xirp2 T C 2: 67,347,431 (GRCm39) V3224A probably damaging Het
Zfp583 G T 7: 6,320,009 (GRCm39) N334K possibly damaging Het
Zfp60 T A 7: 27,447,740 (GRCm39) I136N probably benign Het
Zmynd15 G T 11: 70,356,866 (GRCm39) R722L unknown Het
Other mutations in Atp8b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Atp8b3 APN 10 80,366,821 (GRCm39) missense probably damaging 1.00
IGL00484:Atp8b3 APN 10 80,361,998 (GRCm39) splice site probably benign
IGL00904:Atp8b3 APN 10 80,364,598 (GRCm39) missense probably damaging 1.00
IGL01326:Atp8b3 APN 10 80,360,210 (GRCm39) missense probably damaging 0.98
IGL01368:Atp8b3 APN 10 80,370,063 (GRCm39) splice site probably benign
IGL01448:Atp8b3 APN 10 80,356,256 (GRCm39) missense probably benign 0.02
IGL01556:Atp8b3 APN 10 80,366,802 (GRCm39) nonsense probably null
IGL01754:Atp8b3 APN 10 80,366,795 (GRCm39) splice site probably null
IGL01809:Atp8b3 APN 10 80,355,845 (GRCm39) missense probably benign 0.02
IGL01895:Atp8b3 APN 10 80,357,662 (GRCm39) missense possibly damaging 0.80
IGL02184:Atp8b3 APN 10 80,363,067 (GRCm39) splice site probably benign
IGL02224:Atp8b3 APN 10 80,361,810 (GRCm39) splice site probably benign
IGL02377:Atp8b3 APN 10 80,356,128 (GRCm39) missense probably benign 0.06
IGL02405:Atp8b3 APN 10 80,366,462 (GRCm39) missense probably damaging 1.00
IGL03090:Atp8b3 APN 10 80,366,438 (GRCm39) missense probably damaging 1.00
IGL03244:Atp8b3 APN 10 80,370,292 (GRCm39) missense probably damaging 1.00
PIT4544001:Atp8b3 UTSW 10 80,366,420 (GRCm39) missense probably benign 0.14
R0277:Atp8b3 UTSW 10 80,362,743 (GRCm39) missense probably benign 0.21
R0908:Atp8b3 UTSW 10 80,355,918 (GRCm39) missense probably benign 0.03
R0973:Atp8b3 UTSW 10 80,370,032 (GRCm39) missense probably damaging 1.00
R1069:Atp8b3 UTSW 10 80,366,852 (GRCm39) missense probably damaging 1.00
R1087:Atp8b3 UTSW 10 80,356,017 (GRCm39) missense probably benign 0.00
R1553:Atp8b3 UTSW 10 80,368,376 (GRCm39) missense probably damaging 1.00
R1603:Atp8b3 UTSW 10 80,361,619 (GRCm39) missense probably benign 0.06
R1606:Atp8b3 UTSW 10 80,368,412 (GRCm39) missense probably damaging 1.00
R1707:Atp8b3 UTSW 10 80,357,635 (GRCm39) splice site probably null
R1717:Atp8b3 UTSW 10 80,364,631 (GRCm39) missense probably damaging 1.00
R1876:Atp8b3 UTSW 10 80,365,912 (GRCm39) missense possibly damaging 0.70
R1939:Atp8b3 UTSW 10 80,361,220 (GRCm39) nonsense probably null
R2138:Atp8b3 UTSW 10 80,362,939 (GRCm39) missense possibly damaging 0.79
R2239:Atp8b3 UTSW 10 80,366,822 (GRCm39) missense probably damaging 1.00
R2429:Atp8b3 UTSW 10 80,362,728 (GRCm39) missense probably benign 0.02
R2696:Atp8b3 UTSW 10 80,370,017 (GRCm39) missense possibly damaging 0.94
R2910:Atp8b3 UTSW 10 80,355,746 (GRCm39) missense possibly damaging 0.90
R3424:Atp8b3 UTSW 10 80,372,181 (GRCm39) missense probably benign 0.35
R3425:Atp8b3 UTSW 10 80,372,181 (GRCm39) missense probably benign 0.35
R3432:Atp8b3 UTSW 10 80,362,014 (GRCm39) missense probably benign 0.10
R3841:Atp8b3 UTSW 10 80,365,540 (GRCm39) missense possibly damaging 0.95
R4515:Atp8b3 UTSW 10 80,359,681 (GRCm39) missense probably benign
R4518:Atp8b3 UTSW 10 80,359,681 (GRCm39) missense probably benign
R4519:Atp8b3 UTSW 10 80,359,681 (GRCm39) missense probably benign
R4619:Atp8b3 UTSW 10 80,361,858 (GRCm39) missense possibly damaging 0.67
R4648:Atp8b3 UTSW 10 80,361,457 (GRCm39) missense possibly damaging 0.94
R4709:Atp8b3 UTSW 10 80,372,604 (GRCm39) splice site probably null
R4774:Atp8b3 UTSW 10 80,372,156 (GRCm39) missense probably damaging 1.00
R4796:Atp8b3 UTSW 10 80,360,188 (GRCm39) missense probably damaging 1.00
R5000:Atp8b3 UTSW 10 80,357,676 (GRCm39) missense possibly damaging 0.82
R5398:Atp8b3 UTSW 10 80,365,533 (GRCm39) missense probably damaging 1.00
R5778:Atp8b3 UTSW 10 80,356,007 (GRCm39) missense probably benign
R5990:Atp8b3 UTSW 10 80,361,531 (GRCm39) missense possibly damaging 0.65
R6124:Atp8b3 UTSW 10 80,365,515 (GRCm39) missense probably damaging 1.00
R6427:Atp8b3 UTSW 10 80,356,157 (GRCm39) splice site probably null
R6748:Atp8b3 UTSW 10 80,361,058 (GRCm39) missense possibly damaging 0.56
R6756:Atp8b3 UTSW 10 80,361,895 (GRCm39) missense possibly damaging 0.76
R7051:Atp8b3 UTSW 10 80,365,552 (GRCm39) missense probably damaging 0.99
R7051:Atp8b3 UTSW 10 80,355,858 (GRCm39) missense probably benign 0.02
R7052:Atp8b3 UTSW 10 80,355,858 (GRCm39) missense probably benign 0.02
R7418:Atp8b3 UTSW 10 80,365,926 (GRCm39) missense probably damaging 0.99
R7426:Atp8b3 UTSW 10 80,365,463 (GRCm39) critical splice donor site probably null
R7625:Atp8b3 UTSW 10 80,355,980 (GRCm39) missense probably benign 0.00
R7921:Atp8b3 UTSW 10 80,366,437 (GRCm39) missense probably damaging 1.00
R8077:Atp8b3 UTSW 10 80,366,858 (GRCm39) missense possibly damaging 0.95
R8235:Atp8b3 UTSW 10 80,365,650 (GRCm39) missense probably damaging 0.96
R8354:Atp8b3 UTSW 10 80,361,633 (GRCm39) missense probably benign 0.00
R8454:Atp8b3 UTSW 10 80,361,633 (GRCm39) missense probably benign 0.00
R8501:Atp8b3 UTSW 10 80,355,980 (GRCm39) missense probably benign
R8712:Atp8b3 UTSW 10 80,365,923 (GRCm39) missense possibly damaging 0.52
R8962:Atp8b3 UTSW 10 80,355,896 (GRCm39) missense probably benign 0.13
R9129:Atp8b3 UTSW 10 80,368,412 (GRCm39) missense probably damaging 1.00
R9333:Atp8b3 UTSW 10 80,360,180 (GRCm39) missense probably benign 0.01
R9438:Atp8b3 UTSW 10 80,361,409 (GRCm39) missense probably damaging 1.00
R9486:Atp8b3 UTSW 10 80,366,821 (GRCm39) missense probably damaging 1.00
R9554:Atp8b3 UTSW 10 80,360,197 (GRCm39) missense probably damaging 1.00
R9570:Atp8b3 UTSW 10 80,361,822 (GRCm39) missense probably benign 0.05
R9682:Atp8b3 UTSW 10 80,371,230 (GRCm39) missense probably damaging 1.00
R9748:Atp8b3 UTSW 10 80,364,407 (GRCm39) missense probably damaging 0.96
RF006:Atp8b3 UTSW 10 80,362,070 (GRCm39) missense probably benign 0.15
Z1177:Atp8b3 UTSW 10 80,366,911 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCTGGAGAGATCTGGTTCTCAG -3'
(R):5'- CATGGCATCAGGAGCTCTCTAAG -3'

Sequencing Primer
(F):5'- TTCTCAGAGTGGAGGACCC -3'
(R):5'- AGCTCCTTTAGTCTGAATCAAACCTG -3'
Posted On 2019-11-12