Incidental Mutation 'R7673:Atp8b3'
ID592318
Institutional Source Beutler Lab
Gene Symbol Atp8b3
Ensembl Gene ENSMUSG00000003341
Gene NameATPase, class I, type 8B, member 3
Synonyms1700042F02Rik, SAPLT, 1700056N23Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R7673 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location80519584-80539124 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80524406 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 944 (Y944H)
Ref Sequence ENSEMBL: ENSMUSP00000020383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020383] [ENSMUST00000220326]
Predicted Effect probably damaging
Transcript: ENSMUST00000020383
AA Change: Y944H

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000020383
Gene: ENSMUSG00000003341
AA Change: Y944H

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 20 97 9.3e-29 PFAM
Pfam:E1-E2_ATPase 121 367 2.2e-10 PFAM
Pfam:HAD 404 866 3.7e-17 PFAM
Pfam:Cation_ATPase 481 580 8.3e-12 PFAM
Pfam:PhoLip_ATPase_C 883 1135 4.2e-61 PFAM
low complexity region 1140 1153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220326
AA Change: V857A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to the other. This gene encodes member 3 of phospholipid-transporting ATPase 8B; other members of this protein family are located on chromosomes 1, 15 and 18. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Litters sired by homozygous mutant mice are smaller than those sired by wild-type males. While sperm morphology and motility is intact in null sperm, fertilization rates are reduced due to impaired sperm-egg interactions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh C A 5: 76,882,708 A682S probably benign Het
Acad11 A T 9: 104,063,906 probably null Het
Ahctf1 A T 1: 179,762,846 D1287E probably benign Het
Aldh9a1 C A 1: 167,361,550 L360M probably benign Het
Ank3 A T 10: 69,990,501 I1667F Het
Ccdc30 T C 4: 119,353,172 D316G probably damaging Het
Ccdc50 T C 16: 27,406,675 I46T possibly damaging Het
Cfap74 T G 4: 155,463,056 I1233S unknown Het
Chd9 A G 8: 91,051,697 M2779V probably damaging Het
Cmya5 A T 13: 93,094,121 D1486E probably benign Het
Creb3 T C 4: 43,563,117 V72A not run Het
Cxcl17 C A 7: 25,402,868 C50F probably damaging Het
Dcaf11 C A 14: 55,569,305 N528K probably benign Het
Ddx46 T C 13: 55,659,159 V535A probably benign Het
Det1 A T 7: 78,843,611 V215D possibly damaging Het
Dnaja3 A G 16: 4,694,464 N244S probably benign Het
Dnajc13 G T 9: 104,233,692 P127T probably benign Het
Dnm2 T A 9: 21,481,421 probably null Het
Fam117a G T 11: 95,371,496 R142L probably benign Het
Fpr-rs6 T C 17: 20,182,737 M121V probably benign Het
Gatad1 T C 5: 3,646,867 T95A probably benign Het
Gdap2 A G 3: 100,191,699 D369G probably benign Het
Gm12185 A T 11: 48,907,628 D679E probably benign Het
Gm5519 G C 19: 33,825,028 G157A probably benign Het
Gm960 A C 19: 4,645,633 D530E probably damaging Het
Gmeb2 T A 2: 181,260,388 H123L probably benign Het
Golgb1 C T 16: 36,913,669 P1134S probably benign Het
Gsdmc2 G T 15: 63,825,083 A413D probably damaging Het
Hck C T 2: 153,129,085 A89V possibly damaging Het
Heatr5b G A 17: 78,795,983 T1147M probably damaging Het
Hoxb2 A T 11: 96,353,457 D298V possibly damaging Het
Hrc A G 7: 45,337,234 E603G probably benign Het
Hsd3b5 C A 3: 98,619,441 A230S probably damaging Het
Hsh2d A G 8: 72,200,511 S246G probably benign Het
Ifna4 A C 4: 88,842,072 Q71P possibly damaging Het
Il4i1 A G 7: 44,840,362 E517G probably benign Het
Kdm6b A C 11: 69,405,742 S566R probably damaging Het
Lamc2 T A 1: 153,124,036 Q1192H probably damaging Het
Map2 T C 1: 66,413,774 S608P probably benign Het
March9 T C 10: 127,056,599 E340G probably damaging Het
Mcm3 A G 1: 20,812,014 L442P probably damaging Het
Mreg A C 1: 72,160,964 M189R probably benign Het
Myh4 A T 11: 67,245,513 R406W probably damaging Het
Nol8 A G 13: 49,664,780 D842G probably benign Het
Nrros T A 16: 32,162,281 I10F unknown Het
Obscn G A 11: 59,027,437 P210S Het
Olfr1085 T C 2: 86,657,726 H244R probably damaging Het
Olfr1312 T A 2: 112,042,580 M151L probably benign Het
Olfr889 A T 9: 38,116,227 T149S probably benign Het
Olfr998 T C 2: 85,591,062 I174T possibly damaging Het
Orai1 A G 5: 123,029,442 H226R probably benign Het
Pcdhb18 G T 18: 37,491,737 V707L probably benign Het
Pex5 A T 6: 124,399,383 L420Q probably damaging Het
Rab8a A G 8: 72,161,296 probably benign Het
Rexo4 G A 2: 26,958,493 H339Y probably benign Het
Rif1 G A 2: 52,088,654 V369M probably damaging Het
Rpgrip1l A T 8: 91,300,787 I208K possibly damaging Het
Sbno1 G A 5: 124,413,216 P68L probably benign Het
Selenop G T 15: 3,274,858 C62F probably damaging Het
Slc13a4 A T 6: 35,276,476 V397D probably damaging Het
Slc4a3 T C 1: 75,557,351 V1114A probably damaging Het
Stard3nl A T 13: 19,367,753 S214T probably benign Het
Stra8 T A 6: 34,927,918 probably null Het
Stx8 T C 11: 67,984,639 F97L probably benign Het
Thsd7b A G 1: 129,915,750 probably null Het
Tmem94 T C 11: 115,788,378 I251T probably benign Het
Toporsl A T 4: 52,610,679 T191S probably damaging Het
Vmn1r53 T A 6: 90,223,643 E233V probably damaging Het
Wdr49 A T 3: 75,450,907 L177Q probably damaging Het
Wnt8b T C 19: 44,511,688 L238P possibly damaging Het
Xirp2 T C 2: 67,517,087 V3224A probably damaging Het
Zfp583 G T 7: 6,317,010 N334K possibly damaging Het
Zfp60 T A 7: 27,748,315 I136N probably benign Het
Zmynd15 G T 11: 70,466,040 R722L unknown Het
Other mutations in Atp8b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Atp8b3 APN 10 80530987 missense probably damaging 1.00
IGL00484:Atp8b3 APN 10 80526164 splice site probably benign
IGL00904:Atp8b3 APN 10 80528764 missense probably damaging 1.00
IGL01326:Atp8b3 APN 10 80524376 missense probably damaging 0.98
IGL01368:Atp8b3 APN 10 80534229 splice site probably benign
IGL01448:Atp8b3 APN 10 80520422 missense probably benign 0.02
IGL01556:Atp8b3 APN 10 80530968 nonsense probably null
IGL01754:Atp8b3 APN 10 80530961 splice site probably null
IGL01809:Atp8b3 APN 10 80520011 missense probably benign 0.02
IGL01895:Atp8b3 APN 10 80521828 missense possibly damaging 0.80
IGL02184:Atp8b3 APN 10 80527233 splice site probably benign
IGL02224:Atp8b3 APN 10 80525976 splice site probably benign
IGL02377:Atp8b3 APN 10 80520294 missense probably benign 0.06
IGL02405:Atp8b3 APN 10 80530628 missense probably damaging 1.00
IGL03090:Atp8b3 APN 10 80530604 missense probably damaging 1.00
IGL03244:Atp8b3 APN 10 80534458 missense probably damaging 1.00
PIT4544001:Atp8b3 UTSW 10 80530586 missense probably benign 0.14
R0277:Atp8b3 UTSW 10 80526909 missense probably benign 0.21
R0908:Atp8b3 UTSW 10 80520084 missense probably benign 0.03
R0973:Atp8b3 UTSW 10 80534198 missense probably damaging 1.00
R1069:Atp8b3 UTSW 10 80531018 missense probably damaging 1.00
R1087:Atp8b3 UTSW 10 80520183 missense probably benign 0.00
R1553:Atp8b3 UTSW 10 80532542 missense probably damaging 1.00
R1603:Atp8b3 UTSW 10 80525785 missense probably benign 0.06
R1606:Atp8b3 UTSW 10 80532578 missense probably damaging 1.00
R1707:Atp8b3 UTSW 10 80521801 unclassified probably null
R1717:Atp8b3 UTSW 10 80528797 missense probably damaging 1.00
R1876:Atp8b3 UTSW 10 80530078 missense possibly damaging 0.70
R1939:Atp8b3 UTSW 10 80525386 nonsense probably null
R2138:Atp8b3 UTSW 10 80527105 missense possibly damaging 0.79
R2239:Atp8b3 UTSW 10 80530988 missense probably damaging 1.00
R2429:Atp8b3 UTSW 10 80526894 missense probably benign 0.02
R2696:Atp8b3 UTSW 10 80534183 missense possibly damaging 0.94
R2910:Atp8b3 UTSW 10 80519912 missense possibly damaging 0.90
R3424:Atp8b3 UTSW 10 80536347 missense probably benign 0.35
R3425:Atp8b3 UTSW 10 80536347 missense probably benign 0.35
R3432:Atp8b3 UTSW 10 80526180 missense probably benign 0.10
R3841:Atp8b3 UTSW 10 80529706 missense possibly damaging 0.95
R4515:Atp8b3 UTSW 10 80523847 missense probably benign
R4518:Atp8b3 UTSW 10 80523847 missense probably benign
R4519:Atp8b3 UTSW 10 80523847 missense probably benign
R4619:Atp8b3 UTSW 10 80526024 missense possibly damaging 0.67
R4648:Atp8b3 UTSW 10 80525623 missense possibly damaging 0.94
R4709:Atp8b3 UTSW 10 80536770 unclassified probably null
R4774:Atp8b3 UTSW 10 80536322 missense probably damaging 1.00
R4796:Atp8b3 UTSW 10 80524354 missense probably damaging 1.00
R5000:Atp8b3 UTSW 10 80521842 missense possibly damaging 0.82
R5398:Atp8b3 UTSW 10 80529699 missense probably damaging 1.00
R5778:Atp8b3 UTSW 10 80520173 missense probably benign
R5990:Atp8b3 UTSW 10 80525697 missense possibly damaging 0.65
R6124:Atp8b3 UTSW 10 80529681 missense probably damaging 1.00
R6427:Atp8b3 UTSW 10 80520323 unclassified probably null
R6748:Atp8b3 UTSW 10 80525224 missense possibly damaging 0.56
R6756:Atp8b3 UTSW 10 80526061 missense possibly damaging 0.76
R7051:Atp8b3 UTSW 10 80520024 missense probably benign 0.02
R7051:Atp8b3 UTSW 10 80529718 missense probably damaging 0.99
R7052:Atp8b3 UTSW 10 80520024 missense probably benign 0.02
R7418:Atp8b3 UTSW 10 80530092 missense probably damaging 0.99
R7426:Atp8b3 UTSW 10 80529629 critical splice donor site probably null
R7625:Atp8b3 UTSW 10 80520146 missense probably benign 0.00
R8077:Atp8b3 UTSW 10 80531024 missense possibly damaging 0.95
RF006:Atp8b3 UTSW 10 80526236 missense probably benign 0.15
Z1177:Atp8b3 UTSW 10 80531077 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCTGGAGAGATCTGGTTCTCAG -3'
(R):5'- CATGGCATCAGGAGCTCTCTAAG -3'

Sequencing Primer
(F):5'- TTCTCAGAGTGGAGGACCC -3'
(R):5'- AGCTCCTTTAGTCTGAATCAAACCTG -3'
Posted On2019-11-12