Incidental Mutation 'R7673:Kdm6b'
ID592324
Institutional Source Beutler Lab
Gene Symbol Kdm6b
Ensembl Gene ENSMUSG00000018476
Gene NameKDM1 lysine (K)-specific demethylase 6B
SynonymsJmjd3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7673 (G1)
Quality Score102.008
Status Validated
Chromosome11
Chromosomal Location69398508-69413675 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 69405742 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 566 (S566R)
Ref Sequence ENSEMBL: ENSMUSP00000091620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094077]
PDB Structure The free structure of the mouse C-terminal domain of KDM6B [X-RAY DIFFRACTION]
free KDM6B structure [X-RAY DIFFRACTION]
the crystal structure of KDM6B bound with H3K27me3 peptide [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000094077
AA Change: S566R

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000091620
Gene: ENSMUSG00000018476
AA Change: S566R

DomainStartEndE-ValueType
low complexity region 29 43 N/A INTRINSIC
low complexity region 54 71 N/A INTRINSIC
SCOP:d1elwa_ 91 152 9e-5 SMART
low complexity region 214 227 N/A INTRINSIC
low complexity region 239 270 N/A INTRINSIC
low complexity region 312 329 N/A INTRINSIC
low complexity region 333 345 N/A INTRINSIC
low complexity region 389 415 N/A INTRINSIC
low complexity region 461 487 N/A INTRINSIC
low complexity region 515 524 N/A INTRINSIC
low complexity region 544 577 N/A INTRINSIC
low complexity region 585 615 N/A INTRINSIC
low complexity region 643 650 N/A INTRINSIC
low complexity region 711 719 N/A INTRINSIC
low complexity region 743 766 N/A INTRINSIC
low complexity region 771 811 N/A INTRINSIC
low complexity region 840 879 N/A INTRINSIC
low complexity region 890 909 N/A INTRINSIC
low complexity region 950 989 N/A INTRINSIC
low complexity region 993 1011 N/A INTRINSIC
low complexity region 1044 1068 N/A INTRINSIC
low complexity region 1284 1317 N/A INTRINSIC
JmjC 1337 1500 1.61e-47 SMART
Blast:JmjC 1536 1600 1e-18 BLAST
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a lysine-specific demethylase that specifically demethylates di- or tri-methylated lysine 27 of histone H3 (H3K27me2 or H3K27me3). H3K27 trimethylation is a repressive epigenetic mark controlling chromatin organization and gene silencing. This protein can also demethylate non-histone proteins such as retinoblastoma protein. Through its demethylation actvity this gene influences cellular differentiation and development, tumorigenesis, inflammatory diseases, and neurodegenerative diseases. This protein has two classical nuclear localization signals at its N-terminus. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a null allele show perinatal death, thick alveolar septum, and absence of air space in the lungs. Mice homozygous for a different null allele die neonatally displaying abnormal lung development, dwarfism, kyphosis, short limbs, and a severe delay in endochondral ossification. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh C A 5: 76,882,708 A682S probably benign Het
Acad11 A T 9: 104,063,906 probably null Het
Ahctf1 A T 1: 179,762,846 D1287E probably benign Het
Aldh9a1 C A 1: 167,361,550 L360M probably benign Het
Ank3 A T 10: 69,990,501 I1667F Het
Atp8b3 A G 10: 80,524,406 Y944H probably damaging Het
Ccdc30 T C 4: 119,353,172 D316G probably damaging Het
Ccdc50 T C 16: 27,406,675 I46T possibly damaging Het
Cfap74 T G 4: 155,463,056 I1233S unknown Het
Chd9 A G 8: 91,051,697 M2779V probably damaging Het
Cmya5 A T 13: 93,094,121 D1486E probably benign Het
Creb3 T C 4: 43,563,117 V72A not run Het
Cxcl17 C A 7: 25,402,868 C50F probably damaging Het
Dcaf11 C A 14: 55,569,305 N528K probably benign Het
Ddx46 T C 13: 55,659,159 V535A probably benign Het
Det1 A T 7: 78,843,611 V215D possibly damaging Het
Dnaja3 A G 16: 4,694,464 N244S probably benign Het
Dnajc13 G T 9: 104,233,692 P127T probably benign Het
Dnm2 T A 9: 21,481,421 probably null Het
Fam117a G T 11: 95,371,496 R142L probably benign Het
Fpr-rs6 T C 17: 20,182,737 M121V probably benign Het
Gatad1 T C 5: 3,646,867 T95A probably benign Het
Gdap2 A G 3: 100,191,699 D369G probably benign Het
Gm12185 A T 11: 48,907,628 D679E probably benign Het
Gm5519 G C 19: 33,825,028 G157A probably benign Het
Gm960 A C 19: 4,645,633 D530E probably damaging Het
Gmeb2 T A 2: 181,260,388 H123L probably benign Het
Golgb1 C T 16: 36,913,669 P1134S probably benign Het
Gsdmc2 G T 15: 63,825,083 A413D probably damaging Het
Hck C T 2: 153,129,085 A89V possibly damaging Het
Heatr5b G A 17: 78,795,983 T1147M probably damaging Het
Hoxb2 A T 11: 96,353,457 D298V possibly damaging Het
Hrc A G 7: 45,337,234 E603G probably benign Het
Hsd3b5 C A 3: 98,619,441 A230S probably damaging Het
Hsh2d A G 8: 72,200,511 S246G probably benign Het
Ifna4 A C 4: 88,842,072 Q71P possibly damaging Het
Il4i1 A G 7: 44,840,362 E517G probably benign Het
Lamc2 T A 1: 153,124,036 Q1192H probably damaging Het
Map2 T C 1: 66,413,774 S608P probably benign Het
March9 T C 10: 127,056,599 E340G probably damaging Het
Mcm3 A G 1: 20,812,014 L442P probably damaging Het
Mreg A C 1: 72,160,964 M189R probably benign Het
Myh4 A T 11: 67,245,513 R406W probably damaging Het
Nol8 A G 13: 49,664,780 D842G probably benign Het
Nrros T A 16: 32,162,281 I10F unknown Het
Obscn G A 11: 59,027,437 P210S Het
Olfr1085 T C 2: 86,657,726 H244R probably damaging Het
Olfr1312 T A 2: 112,042,580 M151L probably benign Het
Olfr889 A T 9: 38,116,227 T149S probably benign Het
Olfr998 T C 2: 85,591,062 I174T possibly damaging Het
Orai1 A G 5: 123,029,442 H226R probably benign Het
Pcdhb18 G T 18: 37,491,737 V707L probably benign Het
Pex5 A T 6: 124,399,383 L420Q probably damaging Het
Rab8a A G 8: 72,161,296 probably benign Het
Rexo4 G A 2: 26,958,493 H339Y probably benign Het
Rif1 G A 2: 52,088,654 V369M probably damaging Het
Rpgrip1l A T 8: 91,300,787 I208K possibly damaging Het
Sbno1 G A 5: 124,413,216 P68L probably benign Het
Selenop G T 15: 3,274,858 C62F probably damaging Het
Slc13a4 A T 6: 35,276,476 V397D probably damaging Het
Slc4a3 T C 1: 75,557,351 V1114A probably damaging Het
Stard3nl A T 13: 19,367,753 S214T probably benign Het
Stra8 T A 6: 34,927,918 probably null Het
Stx8 T C 11: 67,984,639 F97L probably benign Het
Thsd7b A G 1: 129,915,750 probably null Het
Tmem94 T C 11: 115,788,378 I251T probably benign Het
Toporsl A T 4: 52,610,679 T191S probably damaging Het
Vmn1r53 T A 6: 90,223,643 E233V probably damaging Het
Wdr49 A T 3: 75,450,907 L177Q probably damaging Het
Wnt8b T C 19: 44,511,688 L238P possibly damaging Het
Xirp2 T C 2: 67,517,087 V3224A probably damaging Het
Zfp583 G T 7: 6,317,010 N334K possibly damaging Het
Zfp60 T A 7: 27,748,315 I136N probably benign Het
Zmynd15 G T 11: 70,466,040 R722L unknown Het
Other mutations in Kdm6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Kdm6b APN 11 69406306 missense possibly damaging 0.85
IGL02271:Kdm6b APN 11 69406067 missense possibly damaging 0.65
beine UTSW 11 69403592 missense unknown
Knochen UTSW 11 69400055 unclassified probably benign
Ostentatious UTSW 11 69403598 missense unknown
Piquant UTSW 11 69403794 missense unknown
Tart UTSW 11 69406366 missense probably damaging 1.00
BB007:Kdm6b UTSW 11 69399952 missense unknown
BB017:Kdm6b UTSW 11 69399952 missense unknown
PIT4458001:Kdm6b UTSW 11 69399952 missense unknown
R0455:Kdm6b UTSW 11 69406996 nonsense probably null
R0645:Kdm6b UTSW 11 69405018 missense unknown
R1659:Kdm6b UTSW 11 69407588 missense possibly damaging 0.88
R1855:Kdm6b UTSW 11 69407286 missense probably damaging 0.99
R1962:Kdm6b UTSW 11 69401365 unclassified probably benign
R1993:Kdm6b UTSW 11 69406303 missense probably null 0.85
R2029:Kdm6b UTSW 11 69403592 missense unknown
R2181:Kdm6b UTSW 11 69401126 nonsense probably null
R2215:Kdm6b UTSW 11 69405044 missense unknown
R2904:Kdm6b UTSW 11 69405785 missense possibly damaging 0.63
R2992:Kdm6b UTSW 11 69406307 small deletion probably benign
R3236:Kdm6b UTSW 11 69406366 missense probably damaging 1.00
R3950:Kdm6b UTSW 11 69405615 missense probably damaging 1.00
R4027:Kdm6b UTSW 11 69406268 missense possibly damaging 0.92
R4830:Kdm6b UTSW 11 69403794 missense unknown
R4996:Kdm6b UTSW 11 69405731 missense probably damaging 1.00
R5034:Kdm6b UTSW 11 69401910 splice site probably benign
R5140:Kdm6b UTSW 11 69400055 unclassified probably benign
R5160:Kdm6b UTSW 11 69400768 unclassified probably benign
R5240:Kdm6b UTSW 11 69401904 splice site probably benign
R5273:Kdm6b UTSW 11 69404201 missense unknown
R5386:Kdm6b UTSW 11 69400810 unclassified probably benign
R5597:Kdm6b UTSW 11 69406074 missense probably damaging 0.96
R5598:Kdm6b UTSW 11 69406074 missense probably damaging 0.96
R5812:Kdm6b UTSW 11 69405929 missense probably damaging 0.98
R5976:Kdm6b UTSW 11 69403788 critical splice donor site probably null
R6000:Kdm6b UTSW 11 69403598 missense unknown
R6145:Kdm6b UTSW 11 69405026 missense unknown
R6191:Kdm6b UTSW 11 69406758 missense probably benign 0.01
R6256:Kdm6b UTSW 11 69406729 missense probably damaging 0.96
R6304:Kdm6b UTSW 11 69404258 missense unknown
R6917:Kdm6b UTSW 11 69406593 missense probably benign 0.04
R6939:Kdm6b UTSW 11 69406762 missense probably damaging 0.99
R7356:Kdm6b UTSW 11 69402165 nonsense probably null
R7644:Kdm6b UTSW 11 69400206 missense unknown
R7698:Kdm6b UTSW 11 69405981 missense probably benign 0.14
R7776:Kdm6b UTSW 11 69406134 missense possibly damaging 0.84
R7930:Kdm6b UTSW 11 69399952 missense unknown
R8383:Kdm6b UTSW 11 69406050 missense probably benign
R8725:Kdm6b UTSW 11 69402093 missense unknown
R8727:Kdm6b UTSW 11 69402093 missense unknown
R8813:Kdm6b UTSW 11 69406829
R8813:Kdm6b UTSW 11 69406832
Z1177:Kdm6b UTSW 11 69403866 missense unknown
Predicted Primers PCR Primer
(F):5'- TCTTTGGGAAGGAGACCCTG -3'
(R):5'- TGGAGAGATCTTAGGGGAGCTC -3'

Sequencing Primer
(F):5'- AGCGCCTGAAGCTTCCTGAG -3'
(R):5'- AGATCTTAGGGGAGCTCTTCTTTG -3'
Posted On2019-11-12