Incidental Mutation 'R7673:Fpr-rs6'
ID592340
Institutional Source Beutler Lab
Gene Symbol Fpr-rs6
Ensembl Gene ENSMUSG00000071275
Gene Nameformyl peptide receptor, related sequence 6
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R7673 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location20182078-20183097 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20182737 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 121 (M121V)
Ref Sequence ENSEMBL: ENSMUSP00000093296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095636]
Predicted Effect probably benign
Transcript: ENSMUST00000095636
AA Change: M121V

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000093296
Gene: ENSMUSG00000071275
AA Change: M121V

DomainStartEndE-ValueType
Pfam:7tm_1 43 297 5.7e-38 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh C A 5: 76,882,708 A682S probably benign Het
Acad11 A T 9: 104,063,906 probably null Het
Ahctf1 A T 1: 179,762,846 D1287E probably benign Het
Aldh9a1 C A 1: 167,361,550 L360M probably benign Het
Ank3 A T 10: 69,990,501 I1667F Het
Atp8b3 A G 10: 80,524,406 Y944H probably damaging Het
Ccdc30 T C 4: 119,353,172 D316G probably damaging Het
Ccdc50 T C 16: 27,406,675 I46T possibly damaging Het
Cfap74 T G 4: 155,463,056 I1233S unknown Het
Chd9 A G 8: 91,051,697 M2779V probably damaging Het
Cmya5 A T 13: 93,094,121 D1486E probably benign Het
Creb3 T C 4: 43,563,117 V72A not run Het
Cxcl17 C A 7: 25,402,868 C50F probably damaging Het
Dcaf11 C A 14: 55,569,305 N528K probably benign Het
Ddx46 T C 13: 55,659,159 V535A probably benign Het
Det1 A T 7: 78,843,611 V215D possibly damaging Het
Dnaja3 A G 16: 4,694,464 N244S probably benign Het
Dnajc13 G T 9: 104,233,692 P127T probably benign Het
Dnm2 T A 9: 21,481,421 probably null Het
Fam117a G T 11: 95,371,496 R142L probably benign Het
Gatad1 T C 5: 3,646,867 T95A probably benign Het
Gdap2 A G 3: 100,191,699 D369G probably benign Het
Gm12185 A T 11: 48,907,628 D679E probably benign Het
Gm5519 G C 19: 33,825,028 G157A probably benign Het
Gm960 A C 19: 4,645,633 D530E probably damaging Het
Gmeb2 T A 2: 181,260,388 H123L probably benign Het
Golgb1 C T 16: 36,913,669 P1134S probably benign Het
Gsdmc2 G T 15: 63,825,083 A413D probably damaging Het
Hck C T 2: 153,129,085 A89V possibly damaging Het
Heatr5b G A 17: 78,795,983 T1147M probably damaging Het
Hoxb2 A T 11: 96,353,457 D298V possibly damaging Het
Hrc A G 7: 45,337,234 E603G probably benign Het
Hsd3b5 C A 3: 98,619,441 A230S probably damaging Het
Hsh2d A G 8: 72,200,511 S246G probably benign Het
Ifna4 A C 4: 88,842,072 Q71P possibly damaging Het
Il4i1 A G 7: 44,840,362 E517G probably benign Het
Kdm6b A C 11: 69,405,742 S566R probably damaging Het
Lamc2 T A 1: 153,124,036 Q1192H probably damaging Het
Map2 T C 1: 66,413,774 S608P probably benign Het
March9 T C 10: 127,056,599 E340G probably damaging Het
Mcm3 A G 1: 20,812,014 L442P probably damaging Het
Mreg A C 1: 72,160,964 M189R probably benign Het
Myh4 A T 11: 67,245,513 R406W probably damaging Het
Nol8 A G 13: 49,664,780 D842G probably benign Het
Nrros T A 16: 32,162,281 I10F unknown Het
Obscn G A 11: 59,027,437 P210S Het
Olfr1085 T C 2: 86,657,726 H244R probably damaging Het
Olfr1312 T A 2: 112,042,580 M151L probably benign Het
Olfr889 A T 9: 38,116,227 T149S probably benign Het
Olfr998 T C 2: 85,591,062 I174T possibly damaging Het
Orai1 A G 5: 123,029,442 H226R probably benign Het
Pcdhb18 G T 18: 37,491,737 V707L probably benign Het
Pex5 A T 6: 124,399,383 L420Q probably damaging Het
Rab8a A G 8: 72,161,296 probably benign Het
Rexo4 G A 2: 26,958,493 H339Y probably benign Het
Rif1 G A 2: 52,088,654 V369M probably damaging Het
Rpgrip1l A T 8: 91,300,787 I208K possibly damaging Het
Sbno1 G A 5: 124,413,216 P68L probably benign Het
Selenop G T 15: 3,274,858 C62F probably damaging Het
Slc13a4 A T 6: 35,276,476 V397D probably damaging Het
Slc4a3 T C 1: 75,557,351 V1114A probably damaging Het
Stard3nl A T 13: 19,367,753 S214T probably benign Het
Stra8 T A 6: 34,927,918 probably null Het
Stx8 T C 11: 67,984,639 F97L probably benign Het
Thsd7b A G 1: 129,915,750 probably null Het
Tmem94 T C 11: 115,788,378 I251T probably benign Het
Toporsl A T 4: 52,610,679 T191S probably damaging Het
Vmn1r53 T A 6: 90,223,643 E233V probably damaging Het
Wdr49 A T 3: 75,450,907 L177Q probably damaging Het
Wnt8b T C 19: 44,511,688 L238P possibly damaging Het
Xirp2 T C 2: 67,517,087 V3224A probably damaging Het
Zfp583 G T 7: 6,317,010 N334K possibly damaging Het
Zfp60 T A 7: 27,748,315 I136N probably benign Het
Zmynd15 G T 11: 70,466,040 R722L unknown Het
Other mutations in Fpr-rs6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02836:Fpr-rs6 APN 17 20183045 missense probably benign 0.30
IGL03380:Fpr-rs6 APN 17 20182983 missense possibly damaging 0.66
R0149:Fpr-rs6 UTSW 17 20182213 missense probably benign 0.29
R0190:Fpr-rs6 UTSW 17 20182479 missense probably benign 0.07
R1347:Fpr-rs6 UTSW 17 20182749 missense probably benign 0.23
R1347:Fpr-rs6 UTSW 17 20182749 missense probably benign 0.23
R1934:Fpr-rs6 UTSW 17 20182890 missense probably benign 0.36
R1965:Fpr-rs6 UTSW 17 20182656 missense probably damaging 0.98
R3690:Fpr-rs6 UTSW 17 20182875 missense probably benign 0.02
R3963:Fpr-rs6 UTSW 17 20182217 missense probably damaging 1.00
R4564:Fpr-rs6 UTSW 17 20182906 nonsense probably null
R4574:Fpr-rs6 UTSW 17 20183097 start codon destroyed probably damaging 1.00
R5015:Fpr-rs6 UTSW 17 20182346 missense probably damaging 1.00
R5599:Fpr-rs6 UTSW 17 20182113 missense probably benign 0.05
R6737:Fpr-rs6 UTSW 17 20183077 missense probably benign 0.08
R6786:Fpr-rs6 UTSW 17 20182838 missense possibly damaging 0.95
R6908:Fpr-rs6 UTSW 17 20182439 missense probably damaging 1.00
R7040:Fpr-rs6 UTSW 17 20182934 missense probably damaging 1.00
R7462:Fpr-rs6 UTSW 17 20182223 missense probably damaging 1.00
R8103:Fpr-rs6 UTSW 17 20182577 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- ATACTTTTACTTGCTCCTCAGGGG -3'
(R):5'- ACAATCTGTTATCTGAACCTGGC -3'

Sequencing Primer
(F):5'- GTTGCAGCCCAGGATTCAAAATTAC -3'
(R):5'- TGAACCTGGCATTGTCTGAC -3'
Posted On2019-11-12