Incidental Mutation 'R7674:Nucks1'
ID592348
Institutional Source Beutler Lab
Gene Symbol Nucks1
Ensembl Gene ENSMUSG00000026434
Gene Namenuclear casein kinase and cyclin-dependent kinase substrate 1
Synonyms2700010L10Rik, Nucks, 8430423A01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.452) question?
Stock #R7674 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location131910534-131936321 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 131931106 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 202 (T202N)
Ref Sequence ENSEMBL: ENSMUSP00000062576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062264] [ENSMUST00000189946]
Predicted Effect probably benign
Transcript: ENSMUST00000062264
AA Change: T202N

PolyPhen 2 Score 0.335 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000062576
Gene: ENSMUSG00000026434
AA Change: T202N

DomainStartEndE-ValueType
low complexity region 54 87 N/A INTRINSIC
low complexity region 90 104 N/A INTRINSIC
low complexity region 109 122 N/A INTRINSIC
low complexity region 132 175 N/A INTRINSIC
low complexity region 192 234 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000189946
AA Change: T201N
SMART Domains Protein: ENSMUSP00000140818
Gene: ENSMUSG00000026434
AA Change: T201N

DomainStartEndE-ValueType
low complexity region 54 87 N/A INTRINSIC
low complexity region 90 104 N/A INTRINSIC
low complexity region 109 122 N/A INTRINSIC
low complexity region 131 174 N/A INTRINSIC
low complexity region 191 233 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that is highly conserved in vertebrates. The conserved regions of the protein contain several consensus phosphorylation sites for casein kinase II and cyclin-dependent kinases, two putative nuclear localization signals, and a basic DNA-binding domain. It is phosphorylated in vivo by Cdk1 during mitosis of the cell cycle. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T G 3: 108,462,991 R698S probably damaging Het
Abca6 T A 11: 110,219,297 I607F probably damaging Het
Abcc4 A T 14: 118,611,487 D559E probably damaging Het
Abl1 T C 2: 31,689,829 V8A possibly damaging Het
Alkal1 A T 1: 6,389,488 Y96F probably damaging Het
Asb3 T A 11: 31,081,435 C352S possibly damaging Het
B4galnt3 G T 6: 120,215,205 D523E probably benign Het
Cadps C A 14: 12,411,581 E1258D probably damaging Het
Carmil2 A T 8: 105,697,286 Q1257L possibly damaging Het
Cars A G 7: 143,587,103 probably null Het
Ccdc88c G T 12: 100,945,232 A781E probably benign Het
Ccr10 A T 11: 101,174,649 D18E probably benign Het
Cdcp1 C A 9: 123,216,006 probably benign Het
Ces5a C A 8: 93,514,269 R400L probably damaging Het
Clcn6 C T 4: 148,012,694 V636M probably damaging Het
Cluh T A 11: 74,667,720 L1206H probably damaging Het
Cog2 C A 8: 124,537,882 N333K probably damaging Het
Dnah14 A T 1: 181,707,533 I2355L probably benign Het
Dok4 T C 8: 94,866,562 Y165C probably damaging Het
Dpy19l3 A C 7: 35,695,309 D601E probably damaging Het
Egr3 G A 14: 70,078,077 probably null Het
Evpl T C 11: 116,222,568 K1432R probably benign Het
Fbxw8 A T 5: 118,124,971 C214* probably null Het
Gm13088 T A 4: 143,655,605 K174* probably null Het
Gm45861 A C 8: 27,540,119 Y821S unknown Het
Gm5519 G C 19: 33,825,028 G157A probably benign Het
Gys1 T C 7: 45,455,071 S641P probably damaging Het
Ighv6-6 T A 12: 114,435,217 I10L probably benign Het
Ikbkap T C 4: 56,792,075 Q231R probably damaging Het
Jmy C T 13: 93,442,599 R675Q probably damaging Het
Kif14 C T 1: 136,468,820 T288I probably damaging Het
Kpna3 A T 14: 61,367,637 N520K probably benign Het
Lonp2 A T 8: 86,665,758 Q484L probably benign Het
Lrp1b T A 2: 42,652,909 probably benign Het
Mpeg1 A T 19: 12,461,387 M70L probably benign Het
Msh3 C A 13: 92,212,503 V1074L probably benign Het
Muc6 A T 7: 141,639,825 L1645Q unknown Het
Nipbl C T 15: 8,293,101 V2609I probably benign Het
Olfr1024 A C 2: 85,904,536 F173V probably damaging Het
Olfr119 A G 17: 37,700,682 N4S probably benign Het
Olfr1262 A T 2: 90,003,045 Y213F probably damaging Het
Olfr1509 A G 14: 52,450,442 T10A probably benign Het
Olfr870 A G 9: 20,171,253 L106P possibly damaging Het
Plekha2 A G 8: 25,057,298 S257P probably damaging Het
Pnlip G C 19: 58,675,154 G187A possibly damaging Het
Rasgrf2 C T 13: 92,131,406 S30N possibly damaging Het
Rho G T 6: 115,932,333 C110F probably damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Slc2a12 A G 10: 22,693,994 D528G probably damaging Het
Sorcs2 G A 5: 36,397,952 R32C probably damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Srp72 A T 5: 76,974,826 N35Y probably damaging Het
Tm2d2 C A 8: 25,018,264 Y141* probably null Het
Tor3a G A 1: 156,655,908 H315Y possibly damaging Het
Usp17la A T 7: 104,861,447 K420* probably null Het
Vmn2r26 T C 6: 124,039,362 W262R probably benign Het
Yipf7 A T 5: 69,519,229 V189D probably damaging Het
Zan T A 5: 137,467,108 M462L possibly damaging Het
Zc3h18 AGG AG 8: 122,383,556 probably null Het
Zfp930 A T 8: 69,228,685 H344L probably damaging Het
Other mutations in Nucks1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01992:Nucks1 APN 1 131931090 missense unknown
IGL02606:Nucks1 APN 1 131924625 missense probably damaging 0.98
R0190:Nucks1 UTSW 1 131924591 missense probably damaging 0.99
R5028:Nucks1 UTSW 1 131928102 missense possibly damaging 0.95
R5377:Nucks1 UTSW 1 131919033 missense probably damaging 0.96
R7921:Nucks1 UTSW 1 131910736 start codon destroyed probably null 0.01
R8483:Nucks1 UTSW 1 131928091 missense possibly damaging 0.92
R8493:Nucks1 UTSW 1 131929735 missense probably benign 0.14
Z1177:Nucks1 UTSW 1 131928176 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GGAGTAATGCGCCTTTTCG -3'
(R):5'- CTGAAAGCCCATGAGTCAAGC -3'

Sequencing Primer
(F):5'- AGTAATGCGCCTTTTCGTGTGTTTC -3'
(R):5'- GCCCATGAGTCAAGCCACAG -3'
Posted On2019-11-12