Incidental Mutation 'R7674:Tor3a'
ID592350
Institutional Source Beutler Lab
Gene Symbol Tor3a
Ensembl Gene ENSMUSG00000060519
Gene Nametorsin family 3, member A
SynonymsAdir
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R7674 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location156653617-156674356 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 156655908 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 315 (H315Y)
Ref Sequence ENSEMBL: ENSMUSP00000078572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079625] [ENSMUST00000122242] [ENSMUST00000150557] [ENSMUST00000156861] [ENSMUST00000188964]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079625
AA Change: H315Y

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000078572
Gene: ENSMUSG00000060519
AA Change: H315Y

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Torsin 93 222 1.1e-60 PFAM
low complexity region 226 246 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000122242
AA Change: H315Y

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113984
Gene: ENSMUSG00000060519
AA Change: H315Y

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Torsin 93 222 1.1e-60 PFAM
low complexity region 226 246 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150557
SMART Domains Protein: ENSMUSP00000137828
Gene: ENSMUSG00000060519

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Torsin 93 206 2.3e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156861
SMART Domains Protein: ENSMUSP00000140808
Gene: ENSMUSG00000060519

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000188964
AA Change: H315Y

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000140079
Gene: ENSMUSG00000060519
AA Change: H315Y

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Torsin 93 222 1.1e-60 PFAM
low complexity region 226 246 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T G 3: 108,462,991 R698S probably damaging Het
Abca6 T A 11: 110,219,297 I607F probably damaging Het
Abcc4 A T 14: 118,611,487 D559E probably damaging Het
Abl1 T C 2: 31,689,829 V8A possibly damaging Het
Alkal1 A T 1: 6,389,488 Y96F probably damaging Het
Asb3 T A 11: 31,081,435 C352S possibly damaging Het
B4galnt3 G T 6: 120,215,205 D523E probably benign Het
Cadps C A 14: 12,411,581 E1258D probably damaging Het
Carmil2 A T 8: 105,697,286 Q1257L possibly damaging Het
Cars A G 7: 143,587,103 probably null Het
Ccdc88c G T 12: 100,945,232 A781E probably benign Het
Ccr10 A T 11: 101,174,649 D18E probably benign Het
Cdcp1 C A 9: 123,216,006 probably benign Het
Ces5a C A 8: 93,514,269 R400L probably damaging Het
Clcn6 C T 4: 148,012,694 V636M probably damaging Het
Cluh T A 11: 74,667,720 L1206H probably damaging Het
Cog2 C A 8: 124,537,882 N333K probably damaging Het
Dnah14 A T 1: 181,707,533 I2355L probably benign Het
Dok4 T C 8: 94,866,562 Y165C probably damaging Het
Dpy19l3 A C 7: 35,695,309 D601E probably damaging Het
Egr3 G A 14: 70,078,077 probably null Het
Evpl T C 11: 116,222,568 K1432R probably benign Het
Fbxw8 A T 5: 118,124,971 C214* probably null Het
Gm13088 T A 4: 143,655,605 K174* probably null Het
Gm45861 A C 8: 27,540,119 Y821S unknown Het
Gm5519 G C 19: 33,825,028 G157A probably benign Het
Gys1 T C 7: 45,455,071 S641P probably damaging Het
Ighv6-6 T A 12: 114,435,217 I10L probably benign Het
Ikbkap T C 4: 56,792,075 Q231R probably damaging Het
Jmy C T 13: 93,442,599 R675Q probably damaging Het
Kif14 C T 1: 136,468,820 T288I probably damaging Het
Kpna3 A T 14: 61,367,637 N520K probably benign Het
Lonp2 A T 8: 86,665,758 Q484L probably benign Het
Lrp1b T A 2: 42,652,909 probably benign Het
Mpeg1 A T 19: 12,461,387 M70L probably benign Het
Msh3 C A 13: 92,212,503 V1074L probably benign Het
Muc6 A T 7: 141,639,825 L1645Q unknown Het
Nipbl C T 15: 8,293,101 V2609I probably benign Het
Nucks1 C A 1: 131,931,106 T202N probably benign Het
Olfr1024 A C 2: 85,904,536 F173V probably damaging Het
Olfr119 A G 17: 37,700,682 N4S probably benign Het
Olfr1262 A T 2: 90,003,045 Y213F probably damaging Het
Olfr1509 A G 14: 52,450,442 T10A probably benign Het
Olfr870 A G 9: 20,171,253 L106P possibly damaging Het
Plekha2 A G 8: 25,057,298 S257P probably damaging Het
Pnlip G C 19: 58,675,154 G187A possibly damaging Het
Rasgrf2 C T 13: 92,131,406 S30N possibly damaging Het
Rho G T 6: 115,932,333 C110F probably damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Slc2a12 A G 10: 22,693,994 D528G probably damaging Het
Sorcs2 G A 5: 36,397,952 R32C probably damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Srp72 A T 5: 76,974,826 N35Y probably damaging Het
Tm2d2 C A 8: 25,018,264 Y141* probably null Het
Usp17la A T 7: 104,861,447 K420* probably null Het
Vmn2r26 T C 6: 124,039,362 W262R probably benign Het
Yipf7 A T 5: 69,519,229 V189D probably damaging Het
Zan T A 5: 137,467,108 M462L possibly damaging Het
Zc3h18 AGG AG 8: 122,383,556 probably null Het
Zfp930 A T 8: 69,228,685 H344L probably damaging Het
Other mutations in Tor3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02173:Tor3a APN 1 156674206 missense probably benign 0.33
IGL03268:Tor3a APN 1 156669450 missense probably damaging 1.00
R2943:Tor3a UTSW 1 156674095 missense probably benign 0.38
R3858:Tor3a UTSW 1 156669554 missense probably damaging 1.00
R4996:Tor3a UTSW 1 156655772 missense probably damaging 1.00
R5204:Tor3a UTSW 1 156655700 missense probably damaging 1.00
R5352:Tor3a UTSW 1 156674193 missense probably damaging 1.00
R5476:Tor3a UTSW 1 156673567 missense possibly damaging 0.94
R5653:Tor3a UTSW 1 156656510 missense probably damaging 1.00
R5931:Tor3a UTSW 1 156656487 missense probably benign 0.03
R6170:Tor3a UTSW 1 156656573 missense possibly damaging 0.89
Z1177:Tor3a UTSW 1 156674230 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- CTCTGGGAAATGGATTTGCAGC -3'
(R):5'- TTCTCCATGCCTAGAATAGCCAC -3'

Sequencing Primer
(F):5'- AATGGATTTGCAGCCCTGAG -3'
(R):5'- CCGCACTGTCCTTGGCAAC -3'
Posted On2019-11-12