Incidental Mutation 'R7674:Dnah14'
ID592351
Institutional Source Beutler Lab
Gene Symbol Dnah14
Ensembl Gene ENSMUSG00000047369
Gene Namedynein, axonemal, heavy chain 14
SynonymsDnahc14, Gm980, LOC381311, A230079K17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R7674 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location181576559-181815774 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 181707533 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 2355 (I2355L)
Ref Sequence ENSEMBL: ENSMUSP00000146843 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000208001
AA Change: I2355L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. Two major classes of dyneins, axonemal and cytoplasmic, have been identified. DNAH14 is an axonemal dynein heavy chain (DHC) (Vaughan et al., 1996 [PubMed 8812413]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T G 3: 108,462,991 R698S probably damaging Het
Abca6 T A 11: 110,219,297 I607F probably damaging Het
Abcc4 A T 14: 118,611,487 D559E probably damaging Het
Abl1 T C 2: 31,689,829 V8A possibly damaging Het
Alkal1 A T 1: 6,389,488 Y96F probably damaging Het
Asb3 T A 11: 31,081,435 C352S possibly damaging Het
B4galnt3 G T 6: 120,215,205 D523E probably benign Het
Cadps C A 14: 12,411,581 E1258D probably damaging Het
Carmil2 A T 8: 105,697,286 Q1257L possibly damaging Het
Cars A G 7: 143,587,103 probably null Het
Ccdc88c G T 12: 100,945,232 A781E probably benign Het
Ccr10 A T 11: 101,174,649 D18E probably benign Het
Cdcp1 C A 9: 123,216,006 probably benign Het
Ces5a C A 8: 93,514,269 R400L probably damaging Het
Clcn6 C T 4: 148,012,694 V636M probably damaging Het
Cluh T A 11: 74,667,720 L1206H probably damaging Het
Cog2 C A 8: 124,537,882 N333K probably damaging Het
Dok4 T C 8: 94,866,562 Y165C probably damaging Het
Dpy19l3 A C 7: 35,695,309 D601E probably damaging Het
Egr3 G A 14: 70,078,077 probably null Het
Evpl T C 11: 116,222,568 K1432R probably benign Het
Fbxw8 A T 5: 118,124,971 C214* probably null Het
Gm13088 T A 4: 143,655,605 K174* probably null Het
Gm45861 A C 8: 27,540,119 Y821S unknown Het
Gm5519 G C 19: 33,825,028 G157A probably benign Het
Gys1 T C 7: 45,455,071 S641P probably damaging Het
Ighv6-6 T A 12: 114,435,217 I10L probably benign Het
Ikbkap T C 4: 56,792,075 Q231R probably damaging Het
Jmy C T 13: 93,442,599 R675Q probably damaging Het
Kif14 C T 1: 136,468,820 T288I probably damaging Het
Kpna3 A T 14: 61,367,637 N520K probably benign Het
Lonp2 A T 8: 86,665,758 Q484L probably benign Het
Lrp1b T A 2: 42,652,909 probably benign Het
Mpeg1 A T 19: 12,461,387 M70L probably benign Het
Msh3 C A 13: 92,212,503 V1074L probably benign Het
Muc6 A T 7: 141,639,825 L1645Q unknown Het
Nipbl C T 15: 8,293,101 V2609I probably benign Het
Nucks1 C A 1: 131,931,106 T202N probably benign Het
Olfr1024 A C 2: 85,904,536 F173V probably damaging Het
Olfr119 A G 17: 37,700,682 N4S probably benign Het
Olfr1262 A T 2: 90,003,045 Y213F probably damaging Het
Olfr1509 A G 14: 52,450,442 T10A probably benign Het
Olfr870 A G 9: 20,171,253 L106P possibly damaging Het
Plekha2 A G 8: 25,057,298 S257P probably damaging Het
Pnlip G C 19: 58,675,154 G187A possibly damaging Het
Rasgrf2 C T 13: 92,131,406 S30N possibly damaging Het
Rho G T 6: 115,932,333 C110F probably damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Slc2a12 A G 10: 22,693,994 D528G probably damaging Het
Sorcs2 G A 5: 36,397,952 R32C probably damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Srp72 A T 5: 76,974,826 N35Y probably damaging Het
Tm2d2 C A 8: 25,018,264 Y141* probably null Het
Tor3a G A 1: 156,655,908 H315Y possibly damaging Het
Usp17la A T 7: 104,861,447 K420* probably null Het
Vmn2r26 T C 6: 124,039,362 W262R probably benign Het
Yipf7 A T 5: 69,519,229 V189D probably damaging Het
Zan T A 5: 137,467,108 M462L possibly damaging Het
Zc3h18 AGG AG 8: 122,383,556 probably null Het
Zfp930 A T 8: 69,228,685 H344L probably damaging Het
Other mutations in Dnah14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Dnah14 APN 1 181752046 missense probably benign 0.17
IGL01764:Dnah14 APN 1 181744777 missense probably benign 0.00
IGL03218:Dnah14 APN 1 181755269 missense probably benign 0.02
IGL03290:Dnah14 APN 1 181763978 splice site probably benign
IGL03384:Dnah14 APN 1 181745949 missense probably benign 0.03
R0009:Dnah14 UTSW 1 181769407 splice site probably benign
R0125:Dnah14 UTSW 1 181752063 missense probably damaging 0.99
R0579:Dnah14 UTSW 1 181744747 missense possibly damaging 0.72
R0973:Dnah14 UTSW 1 181752145 missense probably damaging 1.00
R0973:Dnah14 UTSW 1 181752145 missense probably damaging 1.00
R0974:Dnah14 UTSW 1 181752145 missense probably damaging 1.00
R1609:Dnah14 UTSW 1 181750177 missense probably damaging 0.97
R1860:Dnah14 UTSW 1 181763960 missense probably damaging 1.00
R2050:Dnah14 UTSW 1 181752562 missense probably damaging 1.00
R2974:Dnah14 UTSW 1 181755241 critical splice acceptor site probably null
R4715:Dnah14 UTSW 1 181757223 missense probably damaging 1.00
R5076:Dnah14 UTSW 1 181757234 missense probably benign 0.01
R5424:Dnah14 UTSW 1 181763310 missense possibly damaging 0.95
R5808:Dnah14 UTSW 1 181741159 missense possibly damaging 0.72
R5997:Dnah14 UTSW 1 181770105 missense probably benign 0.00
R6052:Dnah14 UTSW 1 181666487 missense possibly damaging 0.50
R6061:Dnah14 UTSW 1 181709051 missense probably damaging 1.00
R6089:Dnah14 UTSW 1 181750154 missense probably damaging 1.00
R6092:Dnah14 UTSW 1 181621833 missense probably benign 0.13
R6145:Dnah14 UTSW 1 181666417 missense probably benign 0.00
R6163:Dnah14 UTSW 1 181666361 missense probably benign 0.33
R6246:Dnah14 UTSW 1 181680888 missense probably benign 0.00
R6302:Dnah14 UTSW 1 181601206 missense possibly damaging 0.96
R6306:Dnah14 UTSW 1 181585024 frame shift probably null
R6326:Dnah14 UTSW 1 181783556 missense probably damaging 1.00
R6348:Dnah14 UTSW 1 181626720 missense possibly damaging 0.83
R6367:Dnah14 UTSW 1 181755386 splice site probably null
R6376:Dnah14 UTSW 1 181605894 missense possibly damaging 0.79
R6389:Dnah14 UTSW 1 181651202 critical splice donor site probably null
R6433:Dnah14 UTSW 1 181651657 missense probably damaging 0.99
R6454:Dnah14 UTSW 1 181783705 missense probably damaging 1.00
R6476:Dnah14 UTSW 1 181744768 missense probably benign 0.26
R6523:Dnah14 UTSW 1 181643621 missense probably benign 0.00
R6529:Dnah14 UTSW 1 181666469 missense probably damaging 0.98
R6538:Dnah14 UTSW 1 181584985 missense unknown
R6546:Dnah14 UTSW 1 181738987 missense probably damaging 1.00
R6752:Dnah14 UTSW 1 181593452 missense probably benign 0.07
R6762:Dnah14 UTSW 1 181757259 missense probably damaging 1.00
R6786:Dnah14 UTSW 1 181641405 missense probably benign 0.21
R6849:Dnah14 UTSW 1 181808945 missense probably benign 0.00
R6877:Dnah14 UTSW 1 181628432 missense possibly damaging 0.82
R6912:Dnah14 UTSW 1 181750183 missense possibly damaging 0.83
R6919:Dnah14 UTSW 1 181585066 missense probably benign 0.04
R6924:Dnah14 UTSW 1 181627952 missense probably benign 0.04
R6957:Dnah14 UTSW 1 181785175 missense possibly damaging 0.92
R6980:Dnah14 UTSW 1 181648230 missense probably benign 0.00
R7018:Dnah14 UTSW 1 181626944 missense possibly damaging 0.55
R7046:Dnah14 UTSW 1 181623003 missense probably benign 0.01
R7058:Dnah14 UTSW 1 181698049 missense probably benign 0.00
R7068:Dnah14 UTSW 1 181769790 missense probably benign 0.35
R7115:Dnah14 UTSW 1 181720145 missense probably damaging 1.00
R7130:Dnah14 UTSW 1 181745958 nonsense probably null
R7165:Dnah14 UTSW 1 181704535 missense probably benign 0.00
R7169:Dnah14 UTSW 1 181702365 missense probably benign 0.00
R7184:Dnah14 UTSW 1 181704529 nonsense probably null
R7232:Dnah14 UTSW 1 181757363 missense probably damaging 1.00
R7260:Dnah14 UTSW 1 181706744 missense probably damaging 0.99
R7276:Dnah14 UTSW 1 181685807 missense probably benign 0.41
R7290:Dnah14 UTSW 1 181628174 missense probably benign 0.20
R7314:Dnah14 UTSW 1 181785254 splice site probably null
R7326:Dnah14 UTSW 1 181598403 missense probably benign 0.02
R7336:Dnah14 UTSW 1 181797734 missense probably damaging 0.96
R7363:Dnah14 UTSW 1 181690524 splice site probably null
R7371:Dnah14 UTSW 1 181626885 missense probably benign 0.05
R7376:Dnah14 UTSW 1 181763402 missense probably benign 0.03
R7418:Dnah14 UTSW 1 181616742 missense possibly damaging 0.92
R7473:Dnah14 UTSW 1 181752139 missense probably damaging 0.99
R7514:Dnah14 UTSW 1 181628067 missense probably damaging 0.96
R7555:Dnah14 UTSW 1 181770054 missense probably benign 0.26
R7641:Dnah14 UTSW 1 181707533 missense probably benign 0.01
R7663:Dnah14 UTSW 1 181752155 splice site probably null
R7680:Dnah14 UTSW 1 181685800 missense probably benign 0.15
R7709:Dnah14 UTSW 1 181702484 critical splice donor site probably null
R7842:Dnah14 UTSW 1 181627898 missense probably damaging 0.99
R7861:Dnah14 UTSW 1 181616759 missense probably damaging 1.00
R7988:Dnah14 UTSW 1 181783574 missense probably damaging 0.97
R8016:Dnah14 UTSW 1 181648311 missense probably benign 0.05
R8042:Dnah14 UTSW 1 181643631 critical splice donor site probably null
R8071:Dnah14 UTSW 1 181615894 missense possibly damaging 0.84
R8086:Dnah14 UTSW 1 181766232 missense probably damaging 1.00
R8095:Dnah14 UTSW 1 181806032 nonsense probably null
R8139:Dnah14 UTSW 1 181755288 missense probably damaging 1.00
R8176:Dnah14 UTSW 1 181657033 missense probably damaging 0.96
R8193:Dnah14 UTSW 1 181688205 missense probably damaging 1.00
R8197:Dnah14 UTSW 1 181690101 missense possibly damaging 0.94
R8209:Dnah14 UTSW 1 181795545 missense possibly damaging 0.69
R8226:Dnah14 UTSW 1 181795545 missense possibly damaging 0.69
R8251:Dnah14 UTSW 1 181664865 missense probably damaging 1.00
R8264:Dnah14 UTSW 1 181744792 missense probably damaging 0.99
R8284:Dnah14 UTSW 1 181773811 missense probably benign 0.03
R8289:Dnah14 UTSW 1 181716215 nonsense probably null
R8323:Dnah14 UTSW 1 181704544 missense probably benign 0.01
R8442:Dnah14 UTSW 1 181741284 missense probably damaging 0.97
R8458:Dnah14 UTSW 1 181806012 missense
R8507:Dnah14 UTSW 1 181641414 missense probably benign 0.02
R8509:Dnah14 UTSW 1 181814655 missense
RF007:Dnah14 UTSW 1 181685809 missense probably benign 0.00
RF012:Dnah14 UTSW 1 181627898 missense probably damaging 0.99
Z1176:Dnah14 UTSW 1 181757351 missense possibly damaging 0.83
Z1177:Dnah14 UTSW 1 181690320 missense probably benign 0.03
Z1177:Dnah14 UTSW 1 181763334 missense probably damaging 1.00
Z1177:Dnah14 UTSW 1 181766304 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACAGTGGGAAAGTCTAGAACCATC -3'
(R):5'- AGTTAGCGTACTCAGGTGGC -3'

Sequencing Primer
(F):5'- CGGAGCACTGTCATTTAAAGGTC -3'
(R):5'- TACTCAGGTGGCGCAGAG -3'
Posted On2019-11-12