Incidental Mutation 'R7674:Ikbkap'
ID592357
Institutional Source Beutler Lab
Gene Symbol Ikbkap
Ensembl Gene ENSMUSG00000028431
Gene Nameinhibitor of kappa light polypeptide enhancer in B cells, kinase complex-associated protein
SynonymsC78473, Elp1, IKAP, 3110040G09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7674 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location56749680-56802331 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56792075 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 231 (Q231R)
Ref Sequence ENSEMBL: ENSMUSP00000030140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030140]
Predicted Effect probably damaging
Transcript: ENSMUST00000030140
AA Change: Q231R

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030140
Gene: ENSMUSG00000028431
AA Change: Q231R

DomainStartEndE-ValueType
Pfam:IKI3 1 955 N/A PFAM
low complexity region 1186 1205 N/A INTRINSIC
low complexity region 1210 1225 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a scaffold protein and a regulator for three different kinases involved in proinflammatory signaling. The encoded protein can bind NF-kappa-B-inducing kinase and I-kappa-B kinases through separate domains and assemble them into an active kinase complex. Mutations in this gene have been associated with familial dysautonomia. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality with arrested neural and vascular development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T G 3: 108,462,991 R698S probably damaging Het
Abca6 T A 11: 110,219,297 I607F probably damaging Het
Abcc4 A T 14: 118,611,487 D559E probably damaging Het
Abl1 T C 2: 31,689,829 V8A possibly damaging Het
Alkal1 A T 1: 6,389,488 Y96F probably damaging Het
Asb3 T A 11: 31,081,435 C352S possibly damaging Het
B4galnt3 G T 6: 120,215,205 D523E probably benign Het
Cadps C A 14: 12,411,581 E1258D probably damaging Het
Carmil2 A T 8: 105,697,286 Q1257L possibly damaging Het
Cars A G 7: 143,587,103 probably null Het
Ccdc88c G T 12: 100,945,232 A781E probably benign Het
Ccr10 A T 11: 101,174,649 D18E probably benign Het
Cdcp1 C A 9: 123,216,006 probably benign Het
Ces5a C A 8: 93,514,269 R400L probably damaging Het
Clcn6 C T 4: 148,012,694 V636M probably damaging Het
Cluh T A 11: 74,667,720 L1206H probably damaging Het
Cog2 C A 8: 124,537,882 N333K probably damaging Het
Dnah14 A T 1: 181,707,533 I2355L probably benign Het
Dok4 T C 8: 94,866,562 Y165C probably damaging Het
Dpy19l3 A C 7: 35,695,309 D601E probably damaging Het
Egr3 G A 14: 70,078,077 probably null Het
Evpl T C 11: 116,222,568 K1432R probably benign Het
Fbxw8 A T 5: 118,124,971 C214* probably null Het
Gm13088 T A 4: 143,655,605 K174* probably null Het
Gm45861 A C 8: 27,540,119 Y821S unknown Het
Gm5519 G C 19: 33,825,028 G157A probably benign Het
Gys1 T C 7: 45,455,071 S641P probably damaging Het
Ighv6-6 T A 12: 114,435,217 I10L probably benign Het
Jmy C T 13: 93,442,599 R675Q probably damaging Het
Kif14 C T 1: 136,468,820 T288I probably damaging Het
Kpna3 A T 14: 61,367,637 N520K probably benign Het
Lonp2 A T 8: 86,665,758 Q484L probably benign Het
Lrp1b T A 2: 42,652,909 probably benign Het
Mpeg1 A T 19: 12,461,387 M70L probably benign Het
Msh3 C A 13: 92,212,503 V1074L probably benign Het
Muc6 A T 7: 141,639,825 L1645Q unknown Het
Nipbl C T 15: 8,293,101 V2609I probably benign Het
Nucks1 C A 1: 131,931,106 T202N probably benign Het
Olfr1024 A C 2: 85,904,536 F173V probably damaging Het
Olfr119 A G 17: 37,700,682 N4S probably benign Het
Olfr1262 A T 2: 90,003,045 Y213F probably damaging Het
Olfr1509 A G 14: 52,450,442 T10A probably benign Het
Olfr870 A G 9: 20,171,253 L106P possibly damaging Het
Plekha2 A G 8: 25,057,298 S257P probably damaging Het
Pnlip G C 19: 58,675,154 G187A possibly damaging Het
Rasgrf2 C T 13: 92,131,406 S30N possibly damaging Het
Rho G T 6: 115,932,333 C110F probably damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Slc2a12 A G 10: 22,693,994 D528G probably damaging Het
Sorcs2 G A 5: 36,397,952 R32C probably damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Srp72 A T 5: 76,974,826 N35Y probably damaging Het
Tm2d2 C A 8: 25,018,264 Y141* probably null Het
Tor3a G A 1: 156,655,908 H315Y possibly damaging Het
Usp17la A T 7: 104,861,447 K420* probably null Het
Vmn2r26 T C 6: 124,039,362 W262R probably benign Het
Yipf7 A T 5: 69,519,229 V189D probably damaging Het
Zan T A 5: 137,467,108 M462L possibly damaging Het
Zc3h18 AGG AG 8: 122,383,556 probably null Het
Zfp930 A T 8: 69,228,685 H344L probably damaging Het
Other mutations in Ikbkap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Ikbkap APN 4 56784537 critical splice donor site probably null
IGL01521:Ikbkap APN 4 56771059 missense probably benign 0.27
IGL02069:Ikbkap APN 4 56779731 missense probably benign 0.31
IGL02162:Ikbkap APN 4 56796502 critical splice donor site probably null
IGL02252:Ikbkap APN 4 56759813 missense probably benign 0.09
IGL02726:Ikbkap APN 4 56767878 critical splice acceptor site probably null
IGL02822:Ikbkap APN 4 56774520 critical splice donor site probably null
IGL03024:Ikbkap APN 4 56774686 critical splice donor site probably null
IGL03126:Ikbkap APN 4 56779717 missense probably benign
R0211:Ikbkap UTSW 4 56795545 missense probably damaging 1.00
R0239:Ikbkap UTSW 4 56784596 missense probably benign 0.00
R0239:Ikbkap UTSW 4 56784596 missense probably benign 0.00
R0603:Ikbkap UTSW 4 56792105 missense possibly damaging 0.94
R1109:Ikbkap UTSW 4 56786723 missense probably benign 0.00
R1314:Ikbkap UTSW 4 56786647 missense probably benign 0.00
R1333:Ikbkap UTSW 4 56770969 splice site probably benign
R1434:Ikbkap UTSW 4 56781193 missense probably benign 0.02
R1547:Ikbkap UTSW 4 56792090 missense probably damaging 1.00
R1547:Ikbkap UTSW 4 56798810 missense probably damaging 1.00
R1587:Ikbkap UTSW 4 56786666 nonsense probably null
R1601:Ikbkap UTSW 4 56774756 nonsense probably null
R2076:Ikbkap UTSW 4 56786620 missense probably damaging 0.98
R2153:Ikbkap UTSW 4 56779636 splice site probably null
R2263:Ikbkap UTSW 4 56755298 splice site probably null
R2325:Ikbkap UTSW 4 56784622 missense probably benign 0.00
R2333:Ikbkap UTSW 4 56775456 missense probably benign 0.28
R3151:Ikbkap UTSW 4 56770985 missense probably benign 0.24
R3622:Ikbkap UTSW 4 56759925 splice site probably null
R3624:Ikbkap UTSW 4 56798708 missense possibly damaging 0.52
R3889:Ikbkap UTSW 4 56759852 missense probably damaging 1.00
R4007:Ikbkap UTSW 4 56794139 missense probably damaging 1.00
R4196:Ikbkap UTSW 4 56755353 missense probably damaging 1.00
R4794:Ikbkap UTSW 4 56781176 small deletion probably benign
R5330:Ikbkap UTSW 4 56800001 missense probably benign 0.01
R5331:Ikbkap UTSW 4 56800001 missense probably benign 0.01
R5360:Ikbkap UTSW 4 56800104 missense probably benign 0.06
R5362:Ikbkap UTSW 4 56778969 missense probably damaging 0.99
R5645:Ikbkap UTSW 4 56776920 missense possibly damaging 0.93
R5877:Ikbkap UTSW 4 56787807 missense probably damaging 1.00
R6268:Ikbkap UTSW 4 56762305 missense probably damaging 1.00
R6284:Ikbkap UTSW 4 56762281 missense probably damaging 0.99
R6526:Ikbkap UTSW 4 56798812 critical splice acceptor site probably null
R6610:Ikbkap UTSW 4 56758236 missense probably benign 0.02
R6627:Ikbkap UTSW 4 56784647 splice site probably null
R6786:Ikbkap UTSW 4 56771555 missense possibly damaging 0.80
R6823:Ikbkap UTSW 4 56787939 missense probably damaging 1.00
R7129:Ikbkap UTSW 4 56787944 missense probably damaging 1.00
R7157:Ikbkap UTSW 4 56781176 small deletion probably benign
R7180:Ikbkap UTSW 4 56796535 missense probably damaging 1.00
R7391:Ikbkap UTSW 4 56781211 missense possibly damaging 0.82
R7391:Ikbkap UTSW 4 56781212 missense probably benign 0.00
R7403:Ikbkap UTSW 4 56778994 missense probably damaging 1.00
R7432:Ikbkap UTSW 4 56776925 missense probably damaging 1.00
R7736:Ikbkap UTSW 4 56776920 missense possibly damaging 0.93
R7755:Ikbkap UTSW 4 56774552 missense possibly damaging 0.80
R7760:Ikbkap UTSW 4 56790892 missense probably benign 0.20
R7849:Ikbkap UTSW 4 56758968 missense possibly damaging 0.65
R7959:Ikbkap UTSW 4 56774737 missense probably damaging 1.00
R7970:Ikbkap UTSW 4 56771466 missense probably damaging 1.00
R8324:Ikbkap UTSW 4 56772491 missense probably damaging 1.00
R8456:Ikbkap UTSW 4 56781176 small deletion probably benign
R8671:Ikbkap UTSW 4 56771453 missense probably damaging 1.00
Z1176:Ikbkap UTSW 4 56790146 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTTTCCCACAACAGCCATATG -3'
(R):5'- TAGAGATGCCTCCAGGATCC -3'

Sequencing Primer
(F):5'- ACCTTTAAAGAATTAGAGATGCAACC -3'
(R):5'- AGTGGGAAAGAATTGCTGCTTTAG -3'
Posted On2019-11-12