Mutagenetix > Incidental Mutation

Incidental Mutation 'R7674:Sorcs2'

592360

Institutional Source

Beutler Lab

Gene Symbol

Sorcs2

Ensembl Gene

ENSMUSG00000029093

Gene Name

sortilin-related VPS10 domain containing receptor 2

Synonyms

VPS10 domain receptor protein

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7674 (G1)

Quality Score

166.009

Status

Validated

Chromosome

Chromosomal Location

36017180-36398139 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 36397952 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 32 (R32C)

Ref Sequence

ENSEMBL: ENSMUSP00000041828 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037370] [ENSMUST00000070720]

AlphaFold

Q9EPR5

Predicted Effect

probably damaging
Transcript: ENSMUST00000037370
AA Change: R32C

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000041828
Gene: ENSMUSG00000029093
AA Change: R32C

Domain	Start	End	E-Value	Type
signal peptide	1	51	N/A	INTRINSIC
low complexity region	54	64	N/A	INTRINSIC
low complexity region	89	103	N/A	INTRINSIC
low complexity region	106	130	N/A	INTRINSIC
VPS10	170	780	N/A	SMART
PKD	782	872	7.27e-2	SMART
transmembrane domain	1078	1100	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000070720
AA Change: R32C

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000065292
Gene: ENSMUSG00000029093
AA Change: R32C

Domain	Start	End	E-Value	Type
signal peptide	1	51	N/A	INTRINSIC
low complexity region	54	64	N/A	INTRINSIC
low complexity region	89	103	N/A	INTRINSIC
low complexity region	106	130	N/A	INTRINSIC
Blast:VPS10	170	213	2e-22	BLAST
low complexity region	214	227	N/A	INTRINSIC

Meta Mutation Damage Score

0.1651

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to reduced dopamine levels and dopamine metabolism, dopaminergic hyperinnervation of the frontal cortex, hyperactivity, abnormal behavioral response to amphetamine, and decreased induction of Schwann cell apoptosis following sciatic nerve injury. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5330417C22Rik	T	G	3: 108,462,991	R698S	probably damaging	Het
Abca6	T	A	11: 110,219,297	I607F	probably damaging	Het
Abcc4	A	T	14: 118,611,487	D559E	probably damaging	Het
Abl1	T	C	2: 31,689,829	V8A	possibly damaging	Het
Alkal1	A	T	1: 6,389,488	Y96F	probably damaging	Het
Asb3	T	A	11: 31,081,435	C352S	possibly damaging	Het
B4galnt3	G	T	6: 120,215,205	D523E	probably benign	Het
Cadps	C	A	14: 12,411,581	E1258D	probably damaging	Het
Carmil2	A	T	8: 105,697,286	Q1257L	possibly damaging	Het
Cars	A	G	7: 143,587,103		probably null	Het
Ccdc88c	G	T	12: 100,945,232	A781E	probably benign	Het
Ccr10	A	T	11: 101,174,649	D18E	probably benign	Het
Cdcp1	C	A	9: 123,216,006		probably benign	Het
Ces5a	C	A	8: 93,514,269	R400L	probably damaging	Het
Clcn6	C	T	4: 148,012,694	V636M	probably damaging	Het
Cluh	T	A	11: 74,667,720	L1206H	probably damaging	Het
Cog2	C	A	8: 124,537,882	N333K	probably damaging	Het
Dnah14	A	T	1: 181,707,533	I2355L	probably benign	Het
Dok4	T	C	8: 94,866,562	Y165C	probably damaging	Het
Dpy19l3	A	C	7: 35,695,309	D601E	probably damaging	Het
Egr3	G	A	14: 70,078,077		probably null	Het
Evpl	T	C	11: 116,222,568	K1432R	probably benign	Het
Fbxw8	A	T	5: 118,124,971	C214*	probably null	Het
Gm13088	T	A	4: 143,655,605	K174*	probably null	Het
Gm45861	A	C	8: 27,540,119	Y821S	unknown	Het
Gm5519	G	C	19: 33,825,028	G157A	probably benign	Het
Gys1	T	C	7: 45,455,071	S641P	probably damaging	Het
Ighv6-6	T	A	12: 114,435,217	I10L	probably benign	Het
Ikbkap	T	C	4: 56,792,075	Q231R	probably damaging	Het
Jmy	C	T	13: 93,442,599	R675Q	probably damaging	Het
Kif14	C	T	1: 136,468,820	T288I	probably damaging	Het
Kpna3	A	T	14: 61,367,637	N520K	probably benign	Het
Lonp2	A	T	8: 86,665,758	Q484L	probably benign	Het
Lrp1b	T	A	2: 42,652,909		probably benign	Het
Mpeg1	A	T	19: 12,461,387	M70L	probably benign	Het
Msh3	C	A	13: 92,212,503	V1074L	probably benign	Het
Muc6	A	T	7: 141,639,825	L1645Q	unknown	Het
Nipbl	C	T	15: 8,293,101	V2609I	probably benign	Het
Nucks1	C	A	1: 131,931,106	T202N	probably benign	Het
Olfr1024	A	C	2: 85,904,536	F173V	probably damaging	Het
Olfr119	A	G	17: 37,700,682	N4S	probably benign	Het
Olfr1262	A	T	2: 90,003,045	Y213F	probably damaging	Het
Olfr1509	A	G	14: 52,450,442	T10A	probably benign	Het
Olfr870	A	G	9: 20,171,253	L106P	possibly damaging	Het
Plekha2	A	G	8: 25,057,298	S257P	probably damaging	Het
Pnlip	G	C	19: 58,675,154	G187A	possibly damaging	Het
Rasgrf2	C	T	13: 92,131,406	S30N	possibly damaging	Het
Rho	G	T	6: 115,932,333	C110F	probably damaging	Het
Selplg	GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT	GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT	5: 113,819,695		probably benign	Het
Slc2a12	A	G	10: 22,693,994	D528G	probably damaging	Het
Sp110	G	A	1: 85,579,092	R417C	probably benign	Het
Srp72	A	T	5: 76,974,826	N35Y	probably damaging	Het
Tm2d2	C	A	8: 25,018,264	Y141*	probably null	Het
Tor3a	G	A	1: 156,655,908	H315Y	possibly damaging	Het
Usp17la	A	T	7: 104,861,447	K420*	probably null	Het
Vmn2r26	T	C	6: 124,039,362	W262R	probably benign	Het
Yipf7	A	T	5: 69,519,229	V189D	probably damaging	Het
Zan	T	A	5: 137,467,108	M462L	possibly damaging	Het
Zc3h18	AGG	AG	8: 122,383,556		probably null	Het
Zfp930	A	T	8: 69,228,685	H344L	probably damaging	Het

Other mutations in Sorcs2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00401:Sorcs2	APN	5	36037401	splice site	probably null
IGL01064:Sorcs2	APN	5	36065352	missense	probably damaging	1.00
IGL01120:Sorcs2	APN	5	36021252	missense	probably damaging	0.99
IGL01730:Sorcs2	APN	5	36047809	missense	probably damaging	1.00
IGL02542:Sorcs2	APN	5	36025942	missense	probably damaging	0.98
IGL02730:Sorcs2	APN	5	36062552	missense	probably benign	0.11
IGL02965:Sorcs2	APN	5	36077957	missense	probably benign	0.13
IGL02997:Sorcs2	APN	5	36068148	missense	probably damaging	1.00
IGL03000:Sorcs2	APN	5	36065331	unclassified	probably benign
IGL03141:Sorcs2	APN	5	36065355	missense	probably benign	0.01
IGL03184:Sorcs2	APN	5	36031212	missense	probably benign	0.01
IGL03412:Sorcs2	APN	5	36046504	missense	probably damaging	1.00
R0180:Sorcs2	UTSW	5	36153845	missense	probably damaging	1.00
R0244:Sorcs2	UTSW	5	36397553	splice site	probably benign
R0345:Sorcs2	UTSW	5	36027874	missense	probably benign	0.01
R0519:Sorcs2	UTSW	5	36031190	missense	probably benign	0.08
R0624:Sorcs2	UTSW	5	36065433	missense	probably damaging	0.97
R0625:Sorcs2	UTSW	5	36024572	missense	possibly damaging	0.65
R1169:Sorcs2	UTSW	5	36027925	missense	possibly damaging	0.70
R1721:Sorcs2	UTSW	5	36026748	missense	probably damaging	0.98
R1809:Sorcs2	UTSW	5	36229220	splice site	probably benign
R1935:Sorcs2	UTSW	5	36071387	missense	possibly damaging	0.88
R1936:Sorcs2	UTSW	5	36071387	missense	possibly damaging	0.88
R2279:Sorcs2	UTSW	5	36042086	splice site	probably null
R3148:Sorcs2	UTSW	5	36035788	missense	probably benign	0.09
R3803:Sorcs2	UTSW	5	36397806	missense	probably benign	0.36
R3863:Sorcs2	UTSW	5	36397663	nonsense	probably null
R4092:Sorcs2	UTSW	5	36025822	missense	possibly damaging	0.92
R4620:Sorcs2	UTSW	5	36037494	missense	probably benign	0.00
R5079:Sorcs2	UTSW	5	36043452	missense	probably damaging	1.00
R5301:Sorcs2	UTSW	5	36039390	missense	probably damaging	1.00
R5470:Sorcs2	UTSW	5	36031183	missense	probably benign	0.00
R5568:Sorcs2	UTSW	5	36046530	nonsense	probably null
R5727:Sorcs2	UTSW	5	36031286	missense	possibly damaging	0.52
R5874:Sorcs2	UTSW	5	36229211	missense	probably damaging	1.00
R5890:Sorcs2	UTSW	5	36229191	missense	probably damaging	1.00
R5946:Sorcs2	UTSW	5	36029083	missense	probably damaging	1.00
R6005:Sorcs2	UTSW	5	36019384	missense	probably damaging	1.00
R6048:Sorcs2	UTSW	5	36027988	splice site	probably null
R6290:Sorcs2	UTSW	5	36062587	missense	probably damaging	1.00
R6292:Sorcs2	UTSW	5	36062587	missense	probably damaging	1.00
R6617:Sorcs2	UTSW	5	36077966	missense	probably damaging	1.00
R6681:Sorcs2	UTSW	5	36397810	missense	probably benign	0.00
R7024:Sorcs2	UTSW	5	36021261	missense	probably damaging	0.99
R7056:Sorcs2	UTSW	5	36068130	missense	probably damaging	1.00
R7569:Sorcs2	UTSW	5	36025876	missense	probably benign	0.01
R7641:Sorcs2	UTSW	5	36397952	missense	probably damaging	0.99
R7651:Sorcs2	UTSW	5	36027978	missense	probably damaging	1.00
R7722:Sorcs2	UTSW	5	36043527	missense	probably damaging	1.00
R7748:Sorcs2	UTSW	5	36229175	missense	possibly damaging	0.56
R7764:Sorcs2	UTSW	5	36024072	missense	possibly damaging	0.48
R7813:Sorcs2	UTSW	5	36024614	missense	probably damaging	1.00
R8142:Sorcs2	UTSW	5	36062614	missense	possibly damaging	0.67
R8246:Sorcs2	UTSW	5	36062588	missense	probably damaging	1.00
R8254:Sorcs2	UTSW	5	36038206	missense	probably benign	0.00
R8349:Sorcs2	UTSW	5	36229175	missense	possibly damaging	0.56
R8350:Sorcs2	UTSW	5	36153863	missense	probably damaging	0.96
R8354:Sorcs2	UTSW	5	36065409	missense	probably benign	0.01
R8449:Sorcs2	UTSW	5	36229175	missense	possibly damaging	0.56
R8679:Sorcs2	UTSW	5	36039313	missense	probably benign	0.09
R8771:Sorcs2	UTSW	5	36031280	missense	probably damaging	1.00
R8935:Sorcs2	UTSW	5	36035858	missense	possibly damaging	0.79
R8964:Sorcs2	UTSW	5	36229167	missense	possibly damaging	0.85
R9164:Sorcs2	UTSW	5	36077968	missense	possibly damaging	0.94
R9221:Sorcs2	UTSW	5	36024566	critical splice donor site	probably null
R9290:Sorcs2	UTSW	5	36025881	missense	probably damaging	0.96
R9358:Sorcs2	UTSW	5	36043470	missense	probably damaging	1.00
R9492:Sorcs2	UTSW	5	36029140	missense	probably benign	0.08
R9493:Sorcs2	UTSW	5	36042185	missense	possibly damaging	0.61
R9640:Sorcs2	UTSW	5	36065421	nonsense	probably null
RF063:Sorcs2	UTSW	5	36153811	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- GATTCTCGTGCCTGTGGATC -3'
(R):5'- TGACTGCACTCAGGACATCC -3'

Sequencing Primer
(F):5'- ATCTTTGCGATCGCCGGAC -3'
(R):5'- CAGAGCTGCGGTGGCTTG -3'

Posted On

2019-11-12