Incidental Mutation 'R7674:Selplg'
ID592363
Institutional Source Beutler Lab
Gene Symbol Selplg
Ensembl Gene ENSMUSG00000048163
Gene Nameselectin, platelet (p-selectin) ligand
SynonymsPsgl-1, CD162, Psgl1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R7674 (G1)
Quality Score150.457
Status Not validated
Chromosome5
Chromosomal Location113818536-113832644 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT to GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT at 113819695 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000100874] [ENSMUST00000199109]
Predicted Effect probably benign
Transcript: ENSMUST00000100874
SMART Domains Protein: ENSMUSP00000098436
Gene: ENSMUSG00000048163

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
internal_repeat_2 130 182 2.38e-13 PROSPERO
internal_repeat_1 133 186 5.75e-16 PROSPERO
internal_repeat_1 193 246 5.75e-16 PROSPERO
internal_repeat_2 200 252 2.38e-13 PROSPERO
transmembrane domain 328 350 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199109
Predicted Effect probably benign
Transcript: ENSMUST00000201194
Predicted Effect probably benign
Transcript: ENSMUST00000201931
Predicted Effect probably benign
Transcript: ENSMUST00000202555
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein that functions as a high affinity counter-receptor for the cell adhesion molecules P-, E- and L- selectin expressed on myeloid cells and stimulated T lymphocytes. As such, this protein plays a critical role in leukocyte trafficking during inflammation by tethering of leukocytes to activated platelets or endothelia expressing selectins. This protein requires two post-translational modifications, tyrosine sulfation and the addition of the sialyl Lewis x tetrasaccharide (sLex) to its O-linked glycans, for its high-affinity binding activity. Aberrant expression of this gene and polymorphisms in this gene are associated with defects in the innate and adaptive immune response. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Apr 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit neutrophillia and impaired leukocyte adhesion and rolling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T G 3: 108,462,991 R698S probably damaging Het
Abca6 T A 11: 110,219,297 I607F probably damaging Het
Abcc4 A T 14: 118,611,487 D559E probably damaging Het
Abl1 T C 2: 31,689,829 V8A possibly damaging Het
Alkal1 A T 1: 6,389,488 Y96F probably damaging Het
Asb3 T A 11: 31,081,435 C352S possibly damaging Het
B4galnt3 G T 6: 120,215,205 D523E probably benign Het
Cadps C A 14: 12,411,581 E1258D probably damaging Het
Carmil2 A T 8: 105,697,286 Q1257L possibly damaging Het
Cars A G 7: 143,587,103 probably null Het
Ccdc88c G T 12: 100,945,232 A781E probably benign Het
Ccr10 A T 11: 101,174,649 D18E probably benign Het
Cdcp1 C A 9: 123,216,006 probably benign Het
Ces5a C A 8: 93,514,269 R400L probably damaging Het
Clcn6 C T 4: 148,012,694 V636M probably damaging Het
Cluh T A 11: 74,667,720 L1206H probably damaging Het
Cog2 C A 8: 124,537,882 N333K probably damaging Het
Dnah14 A T 1: 181,707,533 I2355L probably benign Het
Dok4 T C 8: 94,866,562 Y165C probably damaging Het
Dpy19l3 A C 7: 35,695,309 D601E probably damaging Het
Egr3 G A 14: 70,078,077 probably null Het
Evpl T C 11: 116,222,568 K1432R probably benign Het
Fbxw8 A T 5: 118,124,971 C214* probably null Het
Gm13088 T A 4: 143,655,605 K174* probably null Het
Gm45861 A C 8: 27,540,119 Y821S unknown Het
Gm5519 G C 19: 33,825,028 G157A probably benign Het
Gys1 T C 7: 45,455,071 S641P probably damaging Het
Ighv6-6 T A 12: 114,435,217 I10L probably benign Het
Ikbkap T C 4: 56,792,075 Q231R probably damaging Het
Jmy C T 13: 93,442,599 R675Q probably damaging Het
Kif14 C T 1: 136,468,820 T288I probably damaging Het
Kpna3 A T 14: 61,367,637 N520K probably benign Het
Lonp2 A T 8: 86,665,758 Q484L probably benign Het
Lrp1b T A 2: 42,652,909 probably benign Het
Mpeg1 A T 19: 12,461,387 M70L probably benign Het
Msh3 C A 13: 92,212,503 V1074L probably benign Het
Muc6 A T 7: 141,639,825 L1645Q unknown Het
Nipbl C T 15: 8,293,101 V2609I probably benign Het
Nucks1 C A 1: 131,931,106 T202N probably benign Het
Olfr1024 A C 2: 85,904,536 F173V probably damaging Het
Olfr119 A G 17: 37,700,682 N4S probably benign Het
Olfr1262 A T 2: 90,003,045 Y213F probably damaging Het
Olfr1509 A G 14: 52,450,442 T10A probably benign Het
Olfr870 A G 9: 20,171,253 L106P possibly damaging Het
Plekha2 A G 8: 25,057,298 S257P probably damaging Het
Pnlip G C 19: 58,675,154 G187A possibly damaging Het
Rasgrf2 C T 13: 92,131,406 S30N possibly damaging Het
Rho G T 6: 115,932,333 C110F probably damaging Het
Slc2a12 A G 10: 22,693,994 D528G probably damaging Het
Sorcs2 G A 5: 36,397,952 R32C probably damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Srp72 A T 5: 76,974,826 N35Y probably damaging Het
Tm2d2 C A 8: 25,018,264 Y141* probably null Het
Tor3a G A 1: 156,655,908 H315Y possibly damaging Het
Usp17la A T 7: 104,861,447 K420* probably null Het
Vmn2r26 T C 6: 124,039,362 W262R probably benign Het
Yipf7 A T 5: 69,519,229 V189D probably damaging Het
Zan T A 5: 137,467,108 M462L possibly damaging Het
Zc3h18 AGG AG 8: 122,383,556 probably null Het
Zfp930 A T 8: 69,228,685 H344L probably damaging Het
Other mutations in Selplg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Selplg APN 5 113819468 missense probably damaging 1.00
IGL01488:Selplg APN 5 113819636 missense possibly damaging 0.78
IGL02355:Selplg APN 5 113819406 missense probably benign 0.00
IGL02362:Selplg APN 5 113819406 missense probably benign 0.00
PIT4142001:Selplg UTSW 5 113819628 missense probably benign 0.00
R0375:Selplg UTSW 5 113820008 missense probably damaging 0.99
R1222:Selplg UTSW 5 113819373 missense possibly damaging 0.95
R1840:Selplg UTSW 5 113819844 missense possibly damaging 0.66
R2925:Selplg UTSW 5 113820179 missense possibly damaging 0.92
R4512:Selplg UTSW 5 113819063 missense probably benign 0.05
R4702:Selplg UTSW 5 113819033 missense probably benign 0.31
R4703:Selplg UTSW 5 113819033 missense probably benign 0.31
R4704:Selplg UTSW 5 113819033 missense probably benign 0.31
R4968:Selplg UTSW 5 113819726 missense possibly damaging 0.93
R5075:Selplg UTSW 5 113819984 missense probably benign 0.00
R6159:Selplg UTSW 5 113819101 missense probably benign 0.02
R6345:Selplg UTSW 5 113820149 missense probably benign 0.03
R6550:Selplg UTSW 5 113820149 missense probably benign 0.03
R6554:Selplg UTSW 5 113820149 missense probably benign 0.03
R6997:Selplg UTSW 5 113819695 unclassified probably benign
R7050:Selplg UTSW 5 113819695 unclassified probably benign
R7094:Selplg UTSW 5 113819695 unclassified probably benign
R7235:Selplg UTSW 5 113819695 unclassified probably benign
R7481:Selplg UTSW 5 113819695 unclassified probably benign
R7604:Selplg UTSW 5 113819695 unclassified probably benign
R7846:Selplg UTSW 5 113819420 missense probably damaging 1.00
R7887:Selplg UTSW 5 113819695 unclassified probably benign
R8051:Selplg UTSW 5 113819441 missense probably damaging 0.99
R8823:Selplg UTSW 5 113819695 unclassified probably benign
R8834:Selplg UTSW 5 113819630 missense possibly damaging 0.64
R8955:Selplg UTSW 5 113819695 unclassified probably benign
Z1177:Selplg UTSW 5 113819351 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- GCTGCAGACGTTGTAAACAG -3'
(R):5'- GTGGAGTCTAACCTCAGTAGAGAC -3'

Sequencing Primer
(F):5'- TTTACAGCCTGAATCCTGGGAAGC -3'
(R):5'- GTCTAACCTCAGTAGAGACCGTCC -3'
Posted On2019-11-12