Mutagenetix > Incidental Mutations

Incidental Mutation 'R7674:Fbxw8'

592364

Institutional Source

Beutler Lab

Gene Symbol

Fbxw8

Ensembl Gene

ENSMUSG00000032867

Gene Name

F-box and WD-40 domain protein 8

Synonyms

Fbx29, FBW6, FBXO29, 4930438M06Rik, FBW8

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.423) question?

Stock #

R7674 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

118064965-118155464 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 118124971 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 214 (C214*)

Ref Sequence

ENSEMBL: ENSMUSP00000047012 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049474]

Predicted Effect

probably null
Transcript: ENSMUST00000049474
AA Change: C214*

SMART Domains

Protein: ENSMUSP00000047012
Gene: ENSMUSG00000032867
AA Change: C214*

Domain	Start	End	E-Value	Type
low complexity region	16	39	N/A	INTRINSIC
low complexity region	51	75	N/A	INTRINSIC
low complexity region	76	91	N/A	INTRINSIC
FBOX	119	159	5e-5	SMART
WD40	198	236	6.16e0	SMART
WD40	248	285	7.1e1	SMART
WD40	289	327	7.36e1	SMART
Blast:WD40	373	418	2e-8	BLAST
WD40	421	461	1.6e0	SMART
WD40	464	501	2.15e-1	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family, members of which are characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into three classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene contains a WD-40 domain, in addition to an F-box motif, so it belongs to the Fbw class. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display partial late embryonic lethality with embryonic growth retardation and abnormal placental morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5330417C22Rik	T	G	3: 108,462,991	R698S	probably damaging	Het
Abca6	T	A	11: 110,219,297	I607F	probably damaging	Het
Abcc4	A	T	14: 118,611,487	D559E	probably damaging	Het
Abl1	T	C	2: 31,689,829	V8A	possibly damaging	Het
Alkal1	A	T	1: 6,389,488	Y96F	probably damaging	Het
Asb3	T	A	11: 31,081,435	C352S	possibly damaging	Het
B4galnt3	G	T	6: 120,215,205	D523E	probably benign	Het
Cadps	C	A	14: 12,411,581	E1258D	probably damaging	Het
Carmil2	A	T	8: 105,697,286	Q1257L	possibly damaging	Het
Cars	A	G	7: 143,587,103		probably null	Het
Ccdc88c	G	T	12: 100,945,232	A781E	probably benign	Het
Ccr10	A	T	11: 101,174,649	D18E	probably benign	Het
Ces5a	C	A	8: 93,514,269	R400L	probably damaging	Het
Clcn6	C	T	4: 148,012,694	V636M	probably damaging	Het
Cluh	T	A	11: 74,667,720	L1206H	probably damaging	Het
Cog2	C	A	8: 124,537,882	N333K	probably damaging	Het
Dnah14	A	T	1: 181,707,533	I2355L	probably benign	Het
Dok4	T	C	8: 94,866,562	Y165C	probably damaging	Het
Dpy19l3	A	C	7: 35,695,309	D601E	probably damaging	Het
Egr3	G	A	14: 70,078,077		probably null	Het
Evpl	T	C	11: 116,222,568	K1432R	probably benign	Het
Gm13088	T	A	4: 143,655,605	K174*	probably null	Het
Gm45861	A	C	8: 27,540,119	Y821S	unknown	Het
Gm5519	G	C	19: 33,825,028	G157A	probably benign	Het
Gys1	T	C	7: 45,455,071	S641P	probably damaging	Het
Ighv6-6	T	A	12: 114,435,217	I10L	probably benign	Het
Ikbkap	T	C	4: 56,792,075	Q231R	probably damaging	Het
Jmy	C	T	13: 93,442,599	R675Q	probably damaging	Het
Kif14	C	T	1: 136,468,820	T288I	probably damaging	Het
Kpna3	A	T	14: 61,367,637	N520K	probably benign	Het
Lonp2	A	T	8: 86,665,758	Q484L	probably benign	Het
Lrp1b	T	A	2: 42,652,909		probably benign	Het
Mpeg1	A	T	19: 12,461,387	M70L	probably benign	Het
Msh3	C	A	13: 92,212,503	V1074L	probably benign	Het
Muc6	A	T	7: 141,639,825	L1645Q	unknown	Het
Nipbl	C	T	15: 8,293,101	V2609I	probably benign	Het
Nucks1	C	A	1: 131,931,106	T202N	probably benign	Het
Olfr1024	A	C	2: 85,904,536	F173V	probably damaging	Het
Olfr119	A	G	17: 37,700,682	N4S	probably benign	Het
Olfr1262	A	T	2: 90,003,045	Y213F	probably damaging	Het
Olfr1509	A	G	14: 52,450,442	T10A	probably benign	Het
Olfr870	A	G	9: 20,171,253	L106P	possibly damaging	Het
Plekha2	A	G	8: 25,057,298	S257P	probably damaging	Het
Pnlip	G	C	19: 58,675,154	G187A	possibly damaging	Het
Rasgrf2	C	T	13: 92,131,406	S30N	possibly damaging	Het
Rho	G	T	6: 115,932,333	C110F	probably damaging	Het
Selplg	GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT	GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT	5: 113,819,695		probably benign	Het
Slc2a12	A	G	10: 22,693,994	D528G	probably damaging	Het
Sorcs2	G	A	5: 36,397,952	R32C	probably damaging	Het
Sp110	G	A	1: 85,579,092	R417C		Het
Srp72	A	T	5: 76,974,826	N35Y	probably damaging	Het
Tor3a	G	A	1: 156,655,908	H315Y	possibly damaging	Het
Usp17la	A	T	7: 104,861,447	K420*	probably null	Het
Vmn2r26	T	C	6: 124,039,362	W262R	probably benign	Het
Yipf7	A	T	5: 69,519,229	V189D	probably damaging	Het
Zan	T	A	5: 137,467,108	M462L	possibly damaging	Het
Zc3h18	AGG	AG	8: 122,383,556		probably null	Het
Zfp930	A	T	8: 69,228,685	H344L	probably damaging	Het

Other mutations in Fbxw8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00272:Fbxw8	APN	5	118068097	missense	probably benign	0.00
IGL00435:Fbxw8	APN	5	118068137	missense	probably benign	0.01
IGL00674:Fbxw8	APN	5	118095593	missense	possibly damaging	0.94
IGL01306:Fbxw8	APN	5	118113720	missense	possibly damaging	0.88
IGL02389:Fbxw8	APN	5	118128955	missense	possibly damaging	0.57
IGL02438:Fbxw8	APN	5	118095693	missense	probably benign	0.09
IGL02553:Fbxw8	APN	5	118066060	unclassified	probably benign
IGL02752:Fbxw8	APN	5	118142750	missense	probably damaging	1.00
IGL02975:Fbxw8	APN	5	118077695	missense	probably benign	0.02
IGL03177:Fbxw8	APN	5	118128980	splice site	probably benign
IGL03333:Fbxw8	APN	5	118095595	missense	possibly damaging	0.94
IGL03407:Fbxw8	APN	5	118142676	missense	probably damaging	1.00
ANU23:Fbxw8	UTSW	5	118113720	missense	possibly damaging	0.88
R0135:Fbxw8	UTSW	5	118070487	missense	probably damaging	1.00
R0760:Fbxw8	UTSW	5	118065901	unclassified	probably null
R1115:Fbxw8	UTSW	5	118077571	splice site	probably benign
R1498:Fbxw8	UTSW	5	118065785	unclassified	probably benign
R1689:Fbxw8	UTSW	5	118077617	missense	probably damaging	0.97
R1897:Fbxw8	UTSW	5	118128876	missense	probably benign	0.16
R2160:Fbxw8	UTSW	5	118124988	missense	probably damaging	1.00
R2345:Fbxw8	UTSW	5	118065807	unclassified	probably benign
R3743:Fbxw8	UTSW	5	118113639	missense	probably damaging	1.00
R3935:Fbxw8	UTSW	5	118095718	missense	probably benign	0.38
R4910:Fbxw8	UTSW	5	118125027	splice site	probably null
R5220:Fbxw8	UTSW	5	118095711	missense	possibly damaging	0.69
R5628:Fbxw8	UTSW	5	118092557	missense	probably damaging	1.00
R6161:Fbxw8	UTSW	5	118092675	missense	possibly damaging	0.94
R6184:Fbxw8	UTSW	5	118113749	missense	probably damaging	1.00
R6582:Fbxw8	UTSW	5	118124963	missense	probably benign	0.28
R6617:Fbxw8	UTSW	5	118142666	critical splice donor site	probably null
R6785:Fbxw8	UTSW	5	118092689	missense	probably damaging	1.00
R7363:Fbxw8	UTSW	5	118124992	missense	probably damaging	0.97
R7395:Fbxw8	UTSW	5	118068215	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTCACTTAGGAGACACACAAATGC -3'
(R):5'- AGCCCACTGACTGGAATGTG -3'

Sequencing Primer
(F):5'- AAAGGAGCTCGTGGCCAC -3'
(R):5'- ACTGGAATGTGGTGCGCAC -3'

Posted On

2019-11-12