Incidental Mutation 'R7674:Vmn2r26'
ID 592368
Institutional Source Beutler Lab
Gene Symbol Vmn2r26
Ensembl Gene ENSMUSG00000096630
Gene Name vomeronasal 2, receptor 26
Synonyms V2r1b
MMRRC Submission 045744-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R7674 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 124001717-124038994 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 124016321 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 262 (W262R)
Ref Sequence ENSEMBL: ENSMUSP00000032238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032238]
AlphaFold Q6TAC4
Predicted Effect probably benign
Transcript: ENSMUST00000032238
AA Change: W262R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032238
Gene: ENSMUSG00000096630
AA Change: W262R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 82 471 1.5e-31 PFAM
Pfam:NCD3G 519 572 4.6e-25 PFAM
Pfam:7tm_3 603 840 1.5e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (58/58)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal vomeronasal sensory neuron physiology and avnosmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T A 11: 110,110,123 (GRCm39) I607F probably damaging Het
Abcc4 A T 14: 118,848,899 (GRCm39) D559E probably damaging Het
Abl1 T C 2: 31,579,841 (GRCm39) V8A possibly damaging Het
Alkal1 A T 1: 6,459,712 (GRCm39) Y96F probably damaging Het
Asb3 T A 11: 31,031,435 (GRCm39) C352S possibly damaging Het
B4galnt3 G T 6: 120,192,166 (GRCm39) D523E probably benign Het
Cadps C A 14: 12,411,581 (GRCm38) E1258D probably damaging Het
Carmil2 A T 8: 106,423,918 (GRCm39) Q1257L possibly damaging Het
Cars1 A G 7: 143,140,840 (GRCm39) probably null Het
Ccdc88c G T 12: 100,911,491 (GRCm39) A781E probably benign Het
Ccr10 A T 11: 101,065,475 (GRCm39) D18E probably benign Het
Cdcp1 C A 9: 123,045,071 (GRCm39) probably benign Het
Ces5a C A 8: 94,240,897 (GRCm39) R400L probably damaging Het
Clcn6 C T 4: 148,097,151 (GRCm39) V636M probably damaging Het
Cluh T A 11: 74,558,546 (GRCm39) L1206H probably damaging Het
Cog2 C A 8: 125,264,621 (GRCm39) N333K probably damaging Het
Dnah14 A T 1: 181,535,098 (GRCm39) I2355L probably benign Het
Dok4 T C 8: 95,593,190 (GRCm39) Y165C probably damaging Het
Dpy19l3 A C 7: 35,394,734 (GRCm39) D601E probably damaging Het
Egr3 G A 14: 70,315,526 (GRCm39) probably null Het
Elapor1 T G 3: 108,370,307 (GRCm39) R698S probably damaging Het
Elp1 T C 4: 56,792,075 (GRCm39) Q231R probably damaging Het
Evpl T C 11: 116,113,394 (GRCm39) K1432R probably benign Het
Fbxw8 A T 5: 118,263,036 (GRCm39) C214* probably null Het
Gm45861 A C 8: 28,030,147 (GRCm39) Y821S unknown Het
Gm5519 G C 19: 33,802,428 (GRCm39) G157A probably benign Het
Gys1 T C 7: 45,104,495 (GRCm39) S641P probably damaging Het
Ighv6-6 T A 12: 114,398,837 (GRCm39) I10L probably benign Het
Jmy C T 13: 93,579,107 (GRCm39) R675Q probably damaging Het
Kif14 C T 1: 136,396,558 (GRCm39) T288I probably damaging Het
Kpna3 A T 14: 61,605,086 (GRCm39) N520K probably benign Het
Lonp2 A T 8: 87,392,386 (GRCm39) Q484L probably benign Het
Lrp1b T A 2: 42,542,921 (GRCm39) probably benign Het
Mpeg1 A T 19: 12,438,751 (GRCm39) M70L probably benign Het
Msh3 C A 13: 92,349,011 (GRCm39) V1074L probably benign Het
Muc6 A T 7: 141,224,247 (GRCm39) L1645Q unknown Het
Nipbl C T 15: 8,322,585 (GRCm39) V2609I probably benign Het
Nucks1 C A 1: 131,858,844 (GRCm39) T202N probably benign Het
Or10al3 A G 17: 38,011,573 (GRCm39) N4S probably benign Het
Or4c127 A T 2: 89,833,389 (GRCm39) Y213F probably damaging Het
Or4e2 A G 14: 52,687,899 (GRCm39) T10A probably benign Het
Or5m12 A C 2: 85,734,880 (GRCm39) F173V probably damaging Het
Or8b12i A G 9: 20,082,549 (GRCm39) L106P possibly damaging Het
Plekha2 A G 8: 25,547,314 (GRCm39) S257P probably damaging Het
Pnlip G C 19: 58,663,586 (GRCm39) G187A possibly damaging Het
Pramel22 T A 4: 143,382,175 (GRCm39) K174* probably null Het
Rasgrf2 C T 13: 92,267,914 (GRCm39) S30N possibly damaging Het
Rho G T 6: 115,909,294 (GRCm39) C110F probably damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,957,756 (GRCm39) probably benign Het
Slc2a12 A G 10: 22,569,893 (GRCm39) D528G probably damaging Het
Sorcs2 G A 5: 36,555,296 (GRCm39) R32C probably damaging Het
Sp110 G A 1: 85,506,813 (GRCm39) R417C probably benign Het
Srp72 A T 5: 77,122,673 (GRCm39) N35Y probably damaging Het
Tm2d2 C A 8: 25,508,280 (GRCm39) Y141* probably null Het
Tor3a G A 1: 156,483,478 (GRCm39) H315Y possibly damaging Het
Usp17la A T 7: 104,510,654 (GRCm39) K420* probably null Het
Yipf7 A T 5: 69,676,572 (GRCm39) V189D probably damaging Het
Zan T A 5: 137,465,370 (GRCm39) M462L possibly damaging Het
Zc3h18 AGG AG 8: 123,110,295 (GRCm39) probably null Het
Zfp930 A T 8: 69,681,337 (GRCm39) H344L probably damaging Het
Other mutations in Vmn2r26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Vmn2r26 APN 6 124,038,566 (GRCm39) missense probably benign 0.00
IGL01370:Vmn2r26 APN 6 124,038,715 (GRCm39) missense probably benign 0.08
IGL01603:Vmn2r26 APN 6 124,030,833 (GRCm39) missense probably damaging 1.00
IGL01651:Vmn2r26 APN 6 124,027,632 (GRCm39) missense probably benign 0.01
IGL02282:Vmn2r26 APN 6 124,038,584 (GRCm39) missense probably damaging 1.00
IGL02425:Vmn2r26 APN 6 124,038,777 (GRCm39) missense probably damaging 1.00
IGL02551:Vmn2r26 APN 6 124,003,100 (GRCm39) missense probably benign 0.11
IGL02690:Vmn2r26 APN 6 124,003,091 (GRCm39) missense probably benign 0.14
IGL03002:Vmn2r26 APN 6 124,016,754 (GRCm39) missense possibly damaging 0.78
IGL03270:Vmn2r26 APN 6 124,027,778 (GRCm39) missense probably benign 0.16
R0032:Vmn2r26 UTSW 6 124,016,858 (GRCm39) missense possibly damaging 0.72
R0052:Vmn2r26 UTSW 6 124,038,992 (GRCm39) makesense probably null
R0083:Vmn2r26 UTSW 6 124,030,940 (GRCm39) splice site probably null
R0682:Vmn2r26 UTSW 6 124,038,129 (GRCm39) missense probably damaging 0.97
R1061:Vmn2r26 UTSW 6 124,038,603 (GRCm39) missense probably benign 0.12
R1077:Vmn2r26 UTSW 6 124,030,872 (GRCm39) missense probably benign 0.00
R1263:Vmn2r26 UTSW 6 124,027,667 (GRCm39) missense probably benign
R1579:Vmn2r26 UTSW 6 124,016,706 (GRCm39) missense probably benign 0.00
R1741:Vmn2r26 UTSW 6 124,038,431 (GRCm39) missense probably damaging 1.00
R1834:Vmn2r26 UTSW 6 124,038,369 (GRCm39) missense possibly damaging 0.54
R1838:Vmn2r26 UTSW 6 124,001,730 (GRCm39) missense probably benign
R1956:Vmn2r26 UTSW 6 124,030,846 (GRCm39) missense probably damaging 1.00
R1996:Vmn2r26 UTSW 6 124,038,144 (GRCm39) missense probably damaging 1.00
R2140:Vmn2r26 UTSW 6 124,038,196 (GRCm39) missense probably benign 0.01
R2327:Vmn2r26 UTSW 6 124,016,708 (GRCm39) missense probably benign 0.07
R2417:Vmn2r26 UTSW 6 124,038,309 (GRCm39) missense probably damaging 1.00
R3930:Vmn2r26 UTSW 6 124,002,938 (GRCm39) missense probably benign
R4490:Vmn2r26 UTSW 6 124,027,697 (GRCm39) missense possibly damaging 0.47
R4629:Vmn2r26 UTSW 6 124,038,150 (GRCm39) missense possibly damaging 0.50
R4655:Vmn2r26 UTSW 6 124,038,375 (GRCm39) missense probably damaging 1.00
R4709:Vmn2r26 UTSW 6 124,030,924 (GRCm39) missense probably damaging 1.00
R4992:Vmn2r26 UTSW 6 124,003,070 (GRCm39) missense probably benign 0.00
R5297:Vmn2r26 UTSW 6 124,038,832 (GRCm39) missense probably damaging 1.00
R5482:Vmn2r26 UTSW 6 124,038,285 (GRCm39) missense possibly damaging 0.88
R5517:Vmn2r26 UTSW 6 124,027,676 (GRCm39) missense probably damaging 1.00
R5737:Vmn2r26 UTSW 6 124,016,408 (GRCm39) missense probably benign 0.00
R5739:Vmn2r26 UTSW 6 124,002,925 (GRCm39) missense probably benign 0.00
R5873:Vmn2r26 UTSW 6 124,038,633 (GRCm39) missense probably benign 0.01
R5907:Vmn2r26 UTSW 6 124,016,830 (GRCm39) missense probably benign 0.00
R6086:Vmn2r26 UTSW 6 124,016,519 (GRCm39) missense possibly damaging 0.48
R6134:Vmn2r26 UTSW 6 124,038,444 (GRCm39) missense probably damaging 0.97
R6391:Vmn2r26 UTSW 6 124,038,348 (GRCm39) missense probably damaging 1.00
R6428:Vmn2r26 UTSW 6 124,003,039 (GRCm39) missense probably benign 0.17
R6637:Vmn2r26 UTSW 6 124,038,650 (GRCm39) missense probably damaging 1.00
R6927:Vmn2r26 UTSW 6 124,016,057 (GRCm39) missense possibly damaging 0.93
R6953:Vmn2r26 UTSW 6 124,016,741 (GRCm39) missense probably benign 0.00
R7173:Vmn2r26 UTSW 6 124,038,255 (GRCm39) missense probably benign 0.16
R7206:Vmn2r26 UTSW 6 124,016,727 (GRCm39) missense probably benign 0.17
R7208:Vmn2r26 UTSW 6 124,038,948 (GRCm39) missense probably damaging 1.00
R7283:Vmn2r26 UTSW 6 124,002,914 (GRCm39) missense probably damaging 0.97
R7506:Vmn2r26 UTSW 6 124,016,700 (GRCm39) missense probably benign 0.00
R7672:Vmn2r26 UTSW 6 124,016,606 (GRCm39) missense probably benign 0.25
R7696:Vmn2r26 UTSW 6 124,038,494 (GRCm39) missense possibly damaging 0.94
R7716:Vmn2r26 UTSW 6 124,038,704 (GRCm39) missense probably damaging 1.00
R7831:Vmn2r26 UTSW 6 124,016,758 (GRCm39) nonsense probably null
R8063:Vmn2r26 UTSW 6 124,001,914 (GRCm39) missense probably benign 0.00
R8331:Vmn2r26 UTSW 6 124,038,887 (GRCm39) missense probably benign 0.22
R8352:Vmn2r26 UTSW 6 124,016,577 (GRCm39) missense probably benign 0.09
R8445:Vmn2r26 UTSW 6 124,002,995 (GRCm39) missense probably damaging 0.97
R8452:Vmn2r26 UTSW 6 124,016,577 (GRCm39) missense probably benign 0.09
R8681:Vmn2r26 UTSW 6 124,001,877 (GRCm39) missense probably benign 0.00
R8914:Vmn2r26 UTSW 6 124,038,983 (GRCm39) missense probably benign
R9333:Vmn2r26 UTSW 6 124,003,009 (GRCm39) missense probably benign 0.13
R9351:Vmn2r26 UTSW 6 124,016,333 (GRCm39) missense probably benign
R9436:Vmn2r26 UTSW 6 124,002,826 (GRCm39) missense probably damaging 1.00
R9515:Vmn2r26 UTSW 6 124,038,137 (GRCm39) missense probably damaging 1.00
RF010:Vmn2r26 UTSW 6 124,016,448 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TCAGTTTTCAATGCACACCG -3'
(R):5'- TGATAATCCTCCACCAAAGTGTG -3'

Sequencing Primer
(F):5'- CAGCTCTGTATCAGGGAATTGTCC -3'
(R):5'- CAGAAGTTGTGATCCAGAC -3'
Posted On 2019-11-12