Incidental Mutation 'R7674:Vmn2r26'
ID 592368
Institutional Source Beutler Lab
Gene Symbol Vmn2r26
Ensembl Gene ENSMUSG00000096630
Gene Name vomeronasal 2, receptor 26
Synonyms V2r1b
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock # R7674 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 124024758-124062035 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 124039362 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 262 (W262R)
Ref Sequence ENSEMBL: ENSMUSP00000032238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032238]
AlphaFold Q6TAC4
Predicted Effect probably benign
Transcript: ENSMUST00000032238
AA Change: W262R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032238
Gene: ENSMUSG00000096630
AA Change: W262R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 82 471 1.5e-31 PFAM
Pfam:NCD3G 519 572 4.6e-25 PFAM
Pfam:7tm_3 603 840 1.5e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (58/58)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal vomeronasal sensory neuron physiology and avnosmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T G 3: 108,462,991 R698S probably damaging Het
Abca6 T A 11: 110,219,297 I607F probably damaging Het
Abcc4 A T 14: 118,611,487 D559E probably damaging Het
Abl1 T C 2: 31,689,829 V8A possibly damaging Het
Alkal1 A T 1: 6,389,488 Y96F probably damaging Het
Asb3 T A 11: 31,081,435 C352S possibly damaging Het
B4galnt3 G T 6: 120,215,205 D523E probably benign Het
Cadps C A 14: 12,411,581 E1258D probably damaging Het
Carmil2 A T 8: 105,697,286 Q1257L possibly damaging Het
Cars A G 7: 143,587,103 probably null Het
Ccdc88c G T 12: 100,945,232 A781E probably benign Het
Ccr10 A T 11: 101,174,649 D18E probably benign Het
Cdcp1 C A 9: 123,216,006 probably benign Het
Ces5a C A 8: 93,514,269 R400L probably damaging Het
Clcn6 C T 4: 148,012,694 V636M probably damaging Het
Cluh T A 11: 74,667,720 L1206H probably damaging Het
Cog2 C A 8: 124,537,882 N333K probably damaging Het
Dnah14 A T 1: 181,707,533 I2355L probably benign Het
Dok4 T C 8: 94,866,562 Y165C probably damaging Het
Dpy19l3 A C 7: 35,695,309 D601E probably damaging Het
Egr3 G A 14: 70,078,077 probably null Het
Evpl T C 11: 116,222,568 K1432R probably benign Het
Fbxw8 A T 5: 118,124,971 C214* probably null Het
Gm13088 T A 4: 143,655,605 K174* probably null Het
Gm45861 A C 8: 27,540,119 Y821S unknown Het
Gm5519 G C 19: 33,825,028 G157A probably benign Het
Gys1 T C 7: 45,455,071 S641P probably damaging Het
Ighv6-6 T A 12: 114,435,217 I10L probably benign Het
Ikbkap T C 4: 56,792,075 Q231R probably damaging Het
Jmy C T 13: 93,442,599 R675Q probably damaging Het
Kif14 C T 1: 136,468,820 T288I probably damaging Het
Kpna3 A T 14: 61,367,637 N520K probably benign Het
Lonp2 A T 8: 86,665,758 Q484L probably benign Het
Lrp1b T A 2: 42,652,909 probably benign Het
Mpeg1 A T 19: 12,461,387 M70L probably benign Het
Msh3 C A 13: 92,212,503 V1074L probably benign Het
Muc6 A T 7: 141,639,825 L1645Q unknown Het
Nipbl C T 15: 8,293,101 V2609I probably benign Het
Nucks1 C A 1: 131,931,106 T202N probably benign Het
Olfr1024 A C 2: 85,904,536 F173V probably damaging Het
Olfr119 A G 17: 37,700,682 N4S probably benign Het
Olfr1262 A T 2: 90,003,045 Y213F probably damaging Het
Olfr1509 A G 14: 52,450,442 T10A probably benign Het
Olfr870 A G 9: 20,171,253 L106P possibly damaging Het
Plekha2 A G 8: 25,057,298 S257P probably damaging Het
Pnlip G C 19: 58,675,154 G187A possibly damaging Het
Rasgrf2 C T 13: 92,131,406 S30N possibly damaging Het
Rho G T 6: 115,932,333 C110F probably damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Slc2a12 A G 10: 22,693,994 D528G probably damaging Het
Sorcs2 G A 5: 36,397,952 R32C probably damaging Het
Sp110 G A 1: 85,579,092 R417C probably benign Het
Srp72 A T 5: 76,974,826 N35Y probably damaging Het
Tm2d2 C A 8: 25,018,264 Y141* probably null Het
Tor3a G A 1: 156,655,908 H315Y possibly damaging Het
Usp17la A T 7: 104,861,447 K420* probably null Het
Yipf7 A T 5: 69,519,229 V189D probably damaging Het
Zan T A 5: 137,467,108 M462L possibly damaging Het
Zc3h18 AGG AG 8: 122,383,556 probably null Het
Zfp930 A T 8: 69,228,685 H344L probably damaging Het
Other mutations in Vmn2r26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Vmn2r26 APN 6 124061607 missense probably benign 0.00
IGL01370:Vmn2r26 APN 6 124061756 missense probably benign 0.08
IGL01603:Vmn2r26 APN 6 124053874 missense probably damaging 1.00
IGL01651:Vmn2r26 APN 6 124050673 missense probably benign 0.01
IGL02282:Vmn2r26 APN 6 124061625 missense probably damaging 1.00
IGL02425:Vmn2r26 APN 6 124061818 missense probably damaging 1.00
IGL02551:Vmn2r26 APN 6 124026141 missense probably benign 0.11
IGL02690:Vmn2r26 APN 6 124026132 missense probably benign 0.14
IGL03002:Vmn2r26 APN 6 124039795 missense possibly damaging 0.78
IGL03270:Vmn2r26 APN 6 124050819 missense probably benign 0.16
R0032:Vmn2r26 UTSW 6 124039899 missense possibly damaging 0.72
R0052:Vmn2r26 UTSW 6 124062033 makesense probably null
R0083:Vmn2r26 UTSW 6 124053981 splice site probably null
R0682:Vmn2r26 UTSW 6 124061170 missense probably damaging 0.97
R1061:Vmn2r26 UTSW 6 124061644 missense probably benign 0.12
R1077:Vmn2r26 UTSW 6 124053913 missense probably benign 0.00
R1263:Vmn2r26 UTSW 6 124050708 missense probably benign
R1579:Vmn2r26 UTSW 6 124039747 missense probably benign 0.00
R1741:Vmn2r26 UTSW 6 124061472 missense probably damaging 1.00
R1834:Vmn2r26 UTSW 6 124061410 missense possibly damaging 0.54
R1838:Vmn2r26 UTSW 6 124024771 missense probably benign
R1956:Vmn2r26 UTSW 6 124053887 missense probably damaging 1.00
R1996:Vmn2r26 UTSW 6 124061185 missense probably damaging 1.00
R2140:Vmn2r26 UTSW 6 124061237 missense probably benign 0.01
R2327:Vmn2r26 UTSW 6 124039749 missense probably benign 0.07
R2417:Vmn2r26 UTSW 6 124061350 missense probably damaging 1.00
R3930:Vmn2r26 UTSW 6 124025979 missense probably benign
R4490:Vmn2r26 UTSW 6 124050738 missense possibly damaging 0.47
R4629:Vmn2r26 UTSW 6 124061191 missense possibly damaging 0.50
R4655:Vmn2r26 UTSW 6 124061416 missense probably damaging 1.00
R4709:Vmn2r26 UTSW 6 124053965 missense probably damaging 1.00
R4992:Vmn2r26 UTSW 6 124026111 missense probably benign 0.00
R5297:Vmn2r26 UTSW 6 124061873 missense probably damaging 1.00
R5482:Vmn2r26 UTSW 6 124061326 missense possibly damaging 0.88
R5517:Vmn2r26 UTSW 6 124050717 missense probably damaging 1.00
R5737:Vmn2r26 UTSW 6 124039449 missense probably benign 0.00
R5739:Vmn2r26 UTSW 6 124025966 missense probably benign 0.00
R5873:Vmn2r26 UTSW 6 124061674 missense probably benign 0.01
R5907:Vmn2r26 UTSW 6 124039871 missense probably benign 0.00
R6086:Vmn2r26 UTSW 6 124039560 missense possibly damaging 0.48
R6134:Vmn2r26 UTSW 6 124061485 missense probably damaging 0.97
R6391:Vmn2r26 UTSW 6 124061389 missense probably damaging 1.00
R6428:Vmn2r26 UTSW 6 124026080 missense probably benign 0.17
R6637:Vmn2r26 UTSW 6 124061691 missense probably damaging 1.00
R6927:Vmn2r26 UTSW 6 124039098 missense possibly damaging 0.93
R6953:Vmn2r26 UTSW 6 124039782 missense probably benign 0.00
R7173:Vmn2r26 UTSW 6 124061296 missense probably benign 0.16
R7206:Vmn2r26 UTSW 6 124039768 missense probably benign 0.17
R7208:Vmn2r26 UTSW 6 124061989 missense probably damaging 1.00
R7283:Vmn2r26 UTSW 6 124025955 missense probably damaging 0.97
R7506:Vmn2r26 UTSW 6 124039741 missense probably benign 0.00
R7672:Vmn2r26 UTSW 6 124039647 missense probably benign 0.25
R7696:Vmn2r26 UTSW 6 124061535 missense possibly damaging 0.94
R7716:Vmn2r26 UTSW 6 124061745 missense probably damaging 1.00
R7831:Vmn2r26 UTSW 6 124039799 nonsense probably null
R8063:Vmn2r26 UTSW 6 124024955 missense probably benign 0.00
R8331:Vmn2r26 UTSW 6 124061928 missense probably benign 0.22
R8352:Vmn2r26 UTSW 6 124039618 missense probably benign 0.09
R8445:Vmn2r26 UTSW 6 124026036 missense probably damaging 0.97
R8452:Vmn2r26 UTSW 6 124039618 missense probably benign 0.09
R8681:Vmn2r26 UTSW 6 124024918 missense probably benign 0.00
R8914:Vmn2r26 UTSW 6 124062024 missense probably benign
R9333:Vmn2r26 UTSW 6 124026050 missense probably benign 0.13
R9351:Vmn2r26 UTSW 6 124039374 missense probably benign
R9436:Vmn2r26 UTSW 6 124025867 missense probably damaging 1.00
R9515:Vmn2r26 UTSW 6 124061178 missense probably damaging 1.00
RF010:Vmn2r26 UTSW 6 124039489 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TCAGTTTTCAATGCACACCG -3'
(R):5'- TGATAATCCTCCACCAAAGTGTG -3'

Sequencing Primer
(F):5'- CAGCTCTGTATCAGGGAATTGTCC -3'
(R):5'- CAGAAGTTGTGATCCAGAC -3'
Posted On 2019-11-12