Incidental Mutation 'R7674:Zfp930'
ID592376
Institutional Source Beutler Lab
Gene Symbol Zfp930
Ensembl Gene ENSMUSG00000059897
Gene Namezinc finger protein 930
SynonymsD10627, zinc finger protein
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7674 (G1)
Quality Score216.009
Status Validated
Chromosome8
Chromosomal Location69209038-69230536 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 69228685 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 344 (H344L)
Ref Sequence ENSEMBL: ENSMUSP00000148587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110216] [ENSMUST00000212312] [ENSMUST00000212681]
Predicted Effect probably damaging
Transcript: ENSMUST00000110216
AA Change: H343L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105845
Gene: ENSMUSG00000059897
AA Change: H343L

DomainStartEndE-ValueType
KRAB 3 62 1.39e-13 SMART
ZnF_C2H2 73 95 1.07e0 SMART
ZnF_C2H2 101 123 6.88e-4 SMART
ZnF_C2H2 129 151 1.98e-4 SMART
ZnF_C2H2 157 179 2.63e0 SMART
ZnF_C2H2 185 207 1.3e-4 SMART
ZnF_C2H2 213 235 1.22e-4 SMART
ZnF_C2H2 241 263 7.49e-5 SMART
ZnF_C2H2 269 291 1.13e-4 SMART
ZnF_C2H2 297 319 1.84e-4 SMART
ZnF_C2H2 325 347 2.27e-4 SMART
ZnF_C2H2 353 375 1.22e-4 SMART
ZnF_C2H2 381 403 5.29e-5 SMART
ZnF_C2H2 409 431 1.72e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212312
Predicted Effect probably damaging
Transcript: ENSMUST00000212681
AA Change: H344L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T G 3: 108,462,991 R698S probably damaging Het
Abca6 T A 11: 110,219,297 I607F probably damaging Het
Abcc4 A T 14: 118,611,487 D559E probably damaging Het
Abl1 T C 2: 31,689,829 V8A possibly damaging Het
Alkal1 A T 1: 6,389,488 Y96F probably damaging Het
Asb3 T A 11: 31,081,435 C352S possibly damaging Het
B4galnt3 G T 6: 120,215,205 D523E probably benign Het
Cadps C A 14: 12,411,581 E1258D probably damaging Het
Carmil2 A T 8: 105,697,286 Q1257L possibly damaging Het
Cars A G 7: 143,587,103 probably null Het
Ccdc88c G T 12: 100,945,232 A781E probably benign Het
Ccr10 A T 11: 101,174,649 D18E probably benign Het
Cdcp1 C A 9: 123,216,006 probably benign Het
Ces5a C A 8: 93,514,269 R400L probably damaging Het
Clcn6 C T 4: 148,012,694 V636M probably damaging Het
Cluh T A 11: 74,667,720 L1206H probably damaging Het
Cog2 C A 8: 124,537,882 N333K probably damaging Het
Dnah14 A T 1: 181,707,533 I2355L probably benign Het
Dok4 T C 8: 94,866,562 Y165C probably damaging Het
Dpy19l3 A C 7: 35,695,309 D601E probably damaging Het
Egr3 G A 14: 70,078,077 probably null Het
Evpl T C 11: 116,222,568 K1432R probably benign Het
Fbxw8 A T 5: 118,124,971 C214* probably null Het
Gm13088 T A 4: 143,655,605 K174* probably null Het
Gm45861 A C 8: 27,540,119 Y821S unknown Het
Gm5519 G C 19: 33,825,028 G157A probably benign Het
Gys1 T C 7: 45,455,071 S641P probably damaging Het
Ighv6-6 T A 12: 114,435,217 I10L probably benign Het
Ikbkap T C 4: 56,792,075 Q231R probably damaging Het
Jmy C T 13: 93,442,599 R675Q probably damaging Het
Kif14 C T 1: 136,468,820 T288I probably damaging Het
Kpna3 A T 14: 61,367,637 N520K probably benign Het
Lonp2 A T 8: 86,665,758 Q484L probably benign Het
Lrp1b T A 2: 42,652,909 probably benign Het
Mpeg1 A T 19: 12,461,387 M70L probably benign Het
Msh3 C A 13: 92,212,503 V1074L probably benign Het
Muc6 A T 7: 141,639,825 L1645Q unknown Het
Nipbl C T 15: 8,293,101 V2609I probably benign Het
Nucks1 C A 1: 131,931,106 T202N probably benign Het
Olfr1024 A C 2: 85,904,536 F173V probably damaging Het
Olfr119 A G 17: 37,700,682 N4S probably benign Het
Olfr1262 A T 2: 90,003,045 Y213F probably damaging Het
Olfr1509 A G 14: 52,450,442 T10A probably benign Het
Olfr870 A G 9: 20,171,253 L106P possibly damaging Het
Plekha2 A G 8: 25,057,298 S257P probably damaging Het
Pnlip G C 19: 58,675,154 G187A possibly damaging Het
Rasgrf2 C T 13: 92,131,406 S30N possibly damaging Het
Rho G T 6: 115,932,333 C110F probably damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Slc2a12 A G 10: 22,693,994 D528G probably damaging Het
Sorcs2 G A 5: 36,397,952 R32C probably damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Srp72 A T 5: 76,974,826 N35Y probably damaging Het
Tm2d2 C A 8: 25,018,264 Y141* probably null Het
Tor3a G A 1: 156,655,908 H315Y possibly damaging Het
Usp17la A T 7: 104,861,447 K420* probably null Het
Vmn2r26 T C 6: 124,039,362 W262R probably benign Het
Yipf7 A T 5: 69,519,229 V189D probably damaging Het
Zan T A 5: 137,467,108 M462L possibly damaging Het
Zc3h18 AGG AG 8: 122,383,556 probably null Het
Other mutations in Zfp930
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Zfp930 APN 8 69227982 missense probably damaging 1.00
Bodyguard UTSW 8 69228685 missense probably damaging 1.00
R0389:Zfp930 UTSW 8 69228296 nonsense probably null
R1275:Zfp930 UTSW 8 69227979 missense possibly damaging 0.73
R1322:Zfp930 UTSW 8 69228168 missense probably benign 0.02
R1802:Zfp930 UTSW 8 69226394 missense possibly damaging 0.50
R1917:Zfp930 UTSW 8 69228705 missense probably benign 0.02
R1918:Zfp930 UTSW 8 69228705 missense probably benign 0.02
R1981:Zfp930 UTSW 8 69228172 missense probably damaging 1.00
R4492:Zfp930 UTSW 8 69228246 nonsense probably null
R4530:Zfp930 UTSW 8 69228831 nonsense probably null
R4769:Zfp930 UTSW 8 69226692 missense probably benign 0.09
R4906:Zfp930 UTSW 8 69228945 missense probably benign 0.11
R5314:Zfp930 UTSW 8 69226721 missense probably benign 0.27
R5708:Zfp930 UTSW 8 69226461 missense probably benign 0.08
R6004:Zfp930 UTSW 8 69227904 missense probably benign
R6385:Zfp930 UTSW 8 69228631 missense probably damaging 1.00
R7095:Zfp930 UTSW 8 69228541 missense probably benign
R7619:Zfp930 UTSW 8 69209158 start codon destroyed probably null 0.95
R7641:Zfp930 UTSW 8 69228685 missense probably damaging 1.00
R8300:Zfp930 UTSW 8 69228346 missense probably benign 0.00
R8905:Zfp930 UTSW 8 69228699 missense possibly damaging 0.78
R8960:Zfp930 UTSW 8 69227889 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTTTTCACAACACAGTAGTC -3'
(R):5'- TCCGAAAAGGCTTTACCACACT -3'

Sequencing Primer
(F):5'- GAGTGTGGTAAAGCCTTTTCACAAC -3'
(R):5'- CACACTGATTACATTCATAGGGC -3'
Posted On2019-11-12