Incidental Mutation 'R7674:Zc3h18'
ID592381
Institutional Source Beutler Lab
Gene Symbol Zc3h18
Ensembl Gene ENSMUSG00000017478
Gene Namezinc finger CCCH-type containing 18
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock #R7674 (G1)
Quality Score217.468
Status Validated
Chromosome8
Chromosomal Location122376609-122417360 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) AGG to AG at 122383556 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000017622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017622] [ENSMUST00000093073] [ENSMUST00000127664] [ENSMUST00000176629] [ENSMUST00000176699]
Predicted Effect probably null
Transcript: ENSMUST00000017622
SMART Domains Protein: ENSMUSP00000017622
Gene: ENSMUSG00000017478

DomainStartEndE-ValueType
coiled coil region 105 129 N/A INTRINSIC
low complexity region 180 205 N/A INTRINSIC
Blast:ZnF_C3H1 215 264 3e-9 BLAST
low complexity region 279 293 N/A INTRINSIC
low complexity region 309 316 N/A INTRINSIC
coiled coil region 418 484 N/A INTRINSIC
low complexity region 552 640 N/A INTRINSIC
low complexity region 642 655 N/A INTRINSIC
low complexity region 658 677 N/A INTRINSIC
low complexity region 689 703 N/A INTRINSIC
low complexity region 705 748 N/A INTRINSIC
low complexity region 756 770 N/A INTRINSIC
low complexity region 794 828 N/A INTRINSIC
low complexity region 871 887 N/A INTRINSIC
low complexity region 898 910 N/A INTRINSIC
coiled coil region 940 968 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000093073
SMART Domains Protein: ENSMUSP00000090761
Gene: ENSMUSG00000017478

DomainStartEndE-ValueType
coiled coil region 105 129 N/A INTRINSIC
low complexity region 180 205 N/A INTRINSIC
ZnF_C3H1 215 240 2.57e-3 SMART
low complexity region 255 269 N/A INTRINSIC
low complexity region 285 292 N/A INTRINSIC
coiled coil region 394 460 N/A INTRINSIC
low complexity region 528 616 N/A INTRINSIC
low complexity region 618 631 N/A INTRINSIC
low complexity region 634 653 N/A INTRINSIC
low complexity region 665 679 N/A INTRINSIC
low complexity region 681 724 N/A INTRINSIC
low complexity region 732 746 N/A INTRINSIC
low complexity region 770 804 N/A INTRINSIC
low complexity region 847 863 N/A INTRINSIC
low complexity region 874 886 N/A INTRINSIC
coiled coil region 916 944 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably null
Transcript: ENSMUST00000176629
SMART Domains Protein: ENSMUSP00000134743
Gene: ENSMUSG00000017478

DomainStartEndE-ValueType
coiled coil region 105 129 N/A INTRINSIC
low complexity region 180 205 N/A INTRINSIC
Blast:ZnF_C3H1 215 264 6e-9 BLAST
low complexity region 279 293 N/A INTRINSIC
low complexity region 309 316 N/A INTRINSIC
coiled coil region 418 484 N/A INTRINSIC
low complexity region 552 640 N/A INTRINSIC
low complexity region 642 655 N/A INTRINSIC
low complexity region 658 677 N/A INTRINSIC
low complexity region 702 726 N/A INTRINSIC
low complexity region 734 748 N/A INTRINSIC
low complexity region 772 806 N/A INTRINSIC
low complexity region 849 865 N/A INTRINSIC
low complexity region 876 888 N/A INTRINSIC
coiled coil region 918 946 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000176699
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T G 3: 108,462,991 R698S probably damaging Het
Abca6 T A 11: 110,219,297 I607F probably damaging Het
Abcc4 A T 14: 118,611,487 D559E probably damaging Het
Abl1 T C 2: 31,689,829 V8A possibly damaging Het
Alkal1 A T 1: 6,389,488 Y96F probably damaging Het
Asb3 T A 11: 31,081,435 C352S possibly damaging Het
B4galnt3 G T 6: 120,215,205 D523E probably benign Het
Cadps C A 14: 12,411,581 E1258D probably damaging Het
Carmil2 A T 8: 105,697,286 Q1257L possibly damaging Het
Cars A G 7: 143,587,103 probably null Het
Ccdc88c G T 12: 100,945,232 A781E probably benign Het
Ccr10 A T 11: 101,174,649 D18E probably benign Het
Cdcp1 C A 9: 123,216,006 probably benign Het
Ces5a C A 8: 93,514,269 R400L probably damaging Het
Clcn6 C T 4: 148,012,694 V636M probably damaging Het
Cluh T A 11: 74,667,720 L1206H probably damaging Het
Cog2 C A 8: 124,537,882 N333K probably damaging Het
Dnah14 A T 1: 181,707,533 I2355L probably benign Het
Dok4 T C 8: 94,866,562 Y165C probably damaging Het
Dpy19l3 A C 7: 35,695,309 D601E probably damaging Het
Egr3 G A 14: 70,078,077 probably null Het
Evpl T C 11: 116,222,568 K1432R probably benign Het
Fbxw8 A T 5: 118,124,971 C214* probably null Het
Gm13088 T A 4: 143,655,605 K174* probably null Het
Gm45861 A C 8: 27,540,119 Y821S unknown Het
Gm5519 G C 19: 33,825,028 G157A probably benign Het
Gys1 T C 7: 45,455,071 S641P probably damaging Het
Ighv6-6 T A 12: 114,435,217 I10L probably benign Het
Ikbkap T C 4: 56,792,075 Q231R probably damaging Het
Jmy C T 13: 93,442,599 R675Q probably damaging Het
Kif14 C T 1: 136,468,820 T288I probably damaging Het
Kpna3 A T 14: 61,367,637 N520K probably benign Het
Lonp2 A T 8: 86,665,758 Q484L probably benign Het
Lrp1b T A 2: 42,652,909 probably benign Het
Mpeg1 A T 19: 12,461,387 M70L probably benign Het
Msh3 C A 13: 92,212,503 V1074L probably benign Het
Muc6 A T 7: 141,639,825 L1645Q unknown Het
Nipbl C T 15: 8,293,101 V2609I probably benign Het
Nucks1 C A 1: 131,931,106 T202N probably benign Het
Olfr1024 A C 2: 85,904,536 F173V probably damaging Het
Olfr119 A G 17: 37,700,682 N4S probably benign Het
Olfr1262 A T 2: 90,003,045 Y213F probably damaging Het
Olfr1509 A G 14: 52,450,442 T10A probably benign Het
Olfr870 A G 9: 20,171,253 L106P possibly damaging Het
Plekha2 A G 8: 25,057,298 S257P probably damaging Het
Pnlip G C 19: 58,675,154 G187A possibly damaging Het
Rasgrf2 C T 13: 92,131,406 S30N possibly damaging Het
Rho G T 6: 115,932,333 C110F probably damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Slc2a12 A G 10: 22,693,994 D528G probably damaging Het
Sorcs2 G A 5: 36,397,952 R32C probably damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Srp72 A T 5: 76,974,826 N35Y probably damaging Het
Tm2d2 C A 8: 25,018,264 Y141* probably null Het
Tor3a G A 1: 156,655,908 H315Y possibly damaging Het
Usp17la A T 7: 104,861,447 K420* probably null Het
Vmn2r26 T C 6: 124,039,362 W262R probably benign Het
Yipf7 A T 5: 69,519,229 V189D probably damaging Het
Zan T A 5: 137,467,108 M462L possibly damaging Het
Zfp930 A T 8: 69,228,685 H344L probably damaging Het
Other mutations in Zc3h18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Zc3h18 APN 8 122386852 unclassified probably benign
IGL01160:Zc3h18 APN 8 122408250 unclassified probably benign
IGL01472:Zc3h18 APN 8 122416657 unclassified probably benign
R1525:Zc3h18 UTSW 8 122413938 missense probably benign 0.34
R1996:Zc3h18 UTSW 8 122407387 unclassified probably benign
R2351:Zc3h18 UTSW 8 122403187 nonsense probably null
R2398:Zc3h18 UTSW 8 122413866 intron probably benign
R2516:Zc3h18 UTSW 8 122403165 intron probably benign
R4435:Zc3h18 UTSW 8 122413952 critical splice donor site probably null
R4734:Zc3h18 UTSW 8 122383643 missense probably damaging 1.00
R4749:Zc3h18 UTSW 8 122383643 missense probably damaging 1.00
R4885:Zc3h18 UTSW 8 122401706 intron probably benign
R4952:Zc3h18 UTSW 8 122410900 unclassified probably benign
R5001:Zc3h18 UTSW 8 122383520 missense probably damaging 1.00
R5098:Zc3h18 UTSW 8 122386869 missense probably damaging 1.00
R5172:Zc3h18 UTSW 8 122407420 unclassified probably benign
R5213:Zc3h18 UTSW 8 122383649 missense probably damaging 1.00
R5337:Zc3h18 UTSW 8 122386902 missense probably damaging 1.00
R5558:Zc3h18 UTSW 8 122386920 missense probably damaging 1.00
R5611:Zc3h18 UTSW 8 122408370 critical splice donor site probably null
R6080:Zc3h18 UTSW 8 122416544 unclassified probably benign
R6315:Zc3h18 UTSW 8 122383865 missense probably benign 0.28
R6349:Zc3h18 UTSW 8 122408286 unclassified probably benign
R7371:Zc3h18 UTSW 8 122413021 missense unknown
R7513:Zc3h18 UTSW 8 122408254 missense unknown
R7684:Zc3h18 UTSW 8 122407426 missense unknown
R7685:Zc3h18 UTSW 8 122413876 missense unknown
R7686:Zc3h18 UTSW 8 122413876 missense unknown
R7849:Zc3h18 UTSW 8 122383971 missense probably damaging 1.00
R8759:Zc3h18 UTSW 8 122411385 missense unknown
R8797:Zc3h18 UTSW 8 122408250 unclassified probably benign
V1024:Zc3h18 UTSW 8 122383857 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCCAGGCTGAGACTATGGTTTG -3'
(R):5'- CAGGGACCTCCTCATCATAGTC -3'

Sequencing Primer
(F):5'- ACTATGGTTTGTGTCTTTTGCAGATC -3'
(R):5'- ATAGTCTAGTTCATGCTCATCCAG -3'
Posted On2019-11-12