Incidental Mutation 'R7674:Cog2'
ID 592382
Institutional Source Beutler Lab
Gene Symbol Cog2
Ensembl Gene ENSMUSG00000031979
Gene Name component of oligomeric golgi complex 2
Synonyms Cog2, 1190002B08Rik, 2700012E02Rik
MMRRC Submission 045744-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7674 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 125247506-125278747 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 125264621 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 333 (N333K)
Ref Sequence ENSEMBL: ENSMUSP00000034460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034460]
AlphaFold Q921L5
Predicted Effect probably damaging
Transcript: ENSMUST00000034460
AA Change: N333K

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000034460
Gene: ENSMUSG00000031979
AA Change: N333K

DomainStartEndE-ValueType
Pfam:COG2 15 147 1.4e-44 PFAM
low complexity region 207 220 N/A INTRINSIC
low complexity region 490 502 N/A INTRINSIC
Pfam:DUF3510 565 692 6.1e-45 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the conserved oligomeric Golgi complex that is required for maintaining normal structure and activity of the Golgi complex. The encoded protein specifically interacts with the USO1 vesicle docking protein and may be necessary for normal Golgi ribbon formation and trafficking of Golgi enzymes. Mutations of this gene are associated with abnormal glycosylation within the Golgi apparatus. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T A 11: 110,110,123 (GRCm39) I607F probably damaging Het
Abcc4 A T 14: 118,848,899 (GRCm39) D559E probably damaging Het
Abl1 T C 2: 31,579,841 (GRCm39) V8A possibly damaging Het
Alkal1 A T 1: 6,459,712 (GRCm39) Y96F probably damaging Het
Asb3 T A 11: 31,031,435 (GRCm39) C352S possibly damaging Het
B4galnt3 G T 6: 120,192,166 (GRCm39) D523E probably benign Het
Cadps C A 14: 12,411,581 (GRCm38) E1258D probably damaging Het
Carmil2 A T 8: 106,423,918 (GRCm39) Q1257L possibly damaging Het
Cars1 A G 7: 143,140,840 (GRCm39) probably null Het
Ccdc88c G T 12: 100,911,491 (GRCm39) A781E probably benign Het
Ccr10 A T 11: 101,065,475 (GRCm39) D18E probably benign Het
Cdcp1 C A 9: 123,045,071 (GRCm39) probably benign Het
Ces5a C A 8: 94,240,897 (GRCm39) R400L probably damaging Het
Clcn6 C T 4: 148,097,151 (GRCm39) V636M probably damaging Het
Cluh T A 11: 74,558,546 (GRCm39) L1206H probably damaging Het
Dnah14 A T 1: 181,535,098 (GRCm39) I2355L probably benign Het
Dok4 T C 8: 95,593,190 (GRCm39) Y165C probably damaging Het
Dpy19l3 A C 7: 35,394,734 (GRCm39) D601E probably damaging Het
Egr3 G A 14: 70,315,526 (GRCm39) probably null Het
Elapor1 T G 3: 108,370,307 (GRCm39) R698S probably damaging Het
Elp1 T C 4: 56,792,075 (GRCm39) Q231R probably damaging Het
Evpl T C 11: 116,113,394 (GRCm39) K1432R probably benign Het
Fbxw8 A T 5: 118,263,036 (GRCm39) C214* probably null Het
Gm45861 A C 8: 28,030,147 (GRCm39) Y821S unknown Het
Gm5519 G C 19: 33,802,428 (GRCm39) G157A probably benign Het
Gys1 T C 7: 45,104,495 (GRCm39) S641P probably damaging Het
Ighv6-6 T A 12: 114,398,837 (GRCm39) I10L probably benign Het
Jmy C T 13: 93,579,107 (GRCm39) R675Q probably damaging Het
Kif14 C T 1: 136,396,558 (GRCm39) T288I probably damaging Het
Kpna3 A T 14: 61,605,086 (GRCm39) N520K probably benign Het
Lonp2 A T 8: 87,392,386 (GRCm39) Q484L probably benign Het
Lrp1b T A 2: 42,542,921 (GRCm39) probably benign Het
Mpeg1 A T 19: 12,438,751 (GRCm39) M70L probably benign Het
Msh3 C A 13: 92,349,011 (GRCm39) V1074L probably benign Het
Muc6 A T 7: 141,224,247 (GRCm39) L1645Q unknown Het
Nipbl C T 15: 8,322,585 (GRCm39) V2609I probably benign Het
Nucks1 C A 1: 131,858,844 (GRCm39) T202N probably benign Het
Or10al3 A G 17: 38,011,573 (GRCm39) N4S probably benign Het
Or4c127 A T 2: 89,833,389 (GRCm39) Y213F probably damaging Het
Or4e2 A G 14: 52,687,899 (GRCm39) T10A probably benign Het
Or5m12 A C 2: 85,734,880 (GRCm39) F173V probably damaging Het
Or8b12i A G 9: 20,082,549 (GRCm39) L106P possibly damaging Het
Plekha2 A G 8: 25,547,314 (GRCm39) S257P probably damaging Het
Pnlip G C 19: 58,663,586 (GRCm39) G187A possibly damaging Het
Pramel22 T A 4: 143,382,175 (GRCm39) K174* probably null Het
Rasgrf2 C T 13: 92,267,914 (GRCm39) S30N possibly damaging Het
Rho G T 6: 115,909,294 (GRCm39) C110F probably damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,957,756 (GRCm39) probably benign Het
Slc2a12 A G 10: 22,569,893 (GRCm39) D528G probably damaging Het
Sorcs2 G A 5: 36,555,296 (GRCm39) R32C probably damaging Het
Sp110 G A 1: 85,506,813 (GRCm39) R417C probably benign Het
Srp72 A T 5: 77,122,673 (GRCm39) N35Y probably damaging Het
Tm2d2 C A 8: 25,508,280 (GRCm39) Y141* probably null Het
Tor3a G A 1: 156,483,478 (GRCm39) H315Y possibly damaging Het
Usp17la A T 7: 104,510,654 (GRCm39) K420* probably null Het
Vmn2r26 T C 6: 124,016,321 (GRCm39) W262R probably benign Het
Yipf7 A T 5: 69,676,572 (GRCm39) V189D probably damaging Het
Zan T A 5: 137,465,370 (GRCm39) M462L possibly damaging Het
Zc3h18 AGG AG 8: 123,110,295 (GRCm39) probably null Het
Zfp930 A T 8: 69,681,337 (GRCm39) H344L probably damaging Het
Other mutations in Cog2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01089:Cog2 APN 8 125,271,982 (GRCm39) missense probably benign 0.00
IGL01092:Cog2 APN 8 125,272,019 (GRCm39) missense probably damaging 1.00
IGL01150:Cog2 APN 8 125,269,630 (GRCm39) missense possibly damaging 0.62
IGL02052:Cog2 APN 8 125,269,627 (GRCm39) critical splice acceptor site probably null
IGL02308:Cog2 APN 8 125,259,951 (GRCm39) critical splice acceptor site probably null
IGL02543:Cog2 APN 8 125,256,698 (GRCm39) missense probably benign 0.09
IGL02978:Cog2 APN 8 125,277,075 (GRCm39) missense probably benign
IGL03008:Cog2 APN 8 125,262,131 (GRCm39) splice site probably benign
IGL03144:Cog2 APN 8 125,267,763 (GRCm39) missense probably damaging 0.98
kugge UTSW 8 125,276,971 (GRCm39) missense probably damaging 1.00
Pelota UTSW 8 125,277,045 (GRCm39) missense probably damaging 1.00
PIT4677001:Cog2 UTSW 8 125,272,010 (GRCm39) missense probably benign 0.22
R0071:Cog2 UTSW 8 125,275,407 (GRCm39) splice site probably benign
R0071:Cog2 UTSW 8 125,275,407 (GRCm39) splice site probably benign
R0110:Cog2 UTSW 8 125,255,797 (GRCm39) critical splice donor site probably null
R0436:Cog2 UTSW 8 125,275,253 (GRCm39) splice site probably benign
R0450:Cog2 UTSW 8 125,255,797 (GRCm39) critical splice donor site probably null
R1365:Cog2 UTSW 8 125,267,713 (GRCm39) missense probably damaging 0.97
R1661:Cog2 UTSW 8 125,269,629 (GRCm39) missense probably benign 0.20
R1698:Cog2 UTSW 8 125,252,422 (GRCm39) missense probably damaging 1.00
R1856:Cog2 UTSW 8 125,278,142 (GRCm39) missense possibly damaging 0.93
R2122:Cog2 UTSW 8 125,255,724 (GRCm39) missense possibly damaging 0.91
R2398:Cog2 UTSW 8 125,256,665 (GRCm39) missense probably benign 0.07
R3855:Cog2 UTSW 8 125,256,742 (GRCm39) critical splice donor site probably null
R4580:Cog2 UTSW 8 125,271,875 (GRCm39) missense probably benign 0.01
R4803:Cog2 UTSW 8 125,262,190 (GRCm39) missense probably damaging 0.96
R5316:Cog2 UTSW 8 125,255,779 (GRCm39) missense probably benign 0.14
R5346:Cog2 UTSW 8 125,273,370 (GRCm39) missense possibly damaging 0.94
R5394:Cog2 UTSW 8 125,259,268 (GRCm39) missense probably benign 0.00
R5395:Cog2 UTSW 8 125,271,960 (GRCm39) missense probably benign 0.00
R5738:Cog2 UTSW 8 125,272,777 (GRCm39) missense probably benign 0.03
R5861:Cog2 UTSW 8 125,264,617 (GRCm39) missense probably damaging 1.00
R5894:Cog2 UTSW 8 125,272,006 (GRCm39) missense probably benign 0.00
R5941:Cog2 UTSW 8 125,272,825 (GRCm39) missense probably benign
R6186:Cog2 UTSW 8 125,273,425 (GRCm39) missense probably damaging 1.00
R6400:Cog2 UTSW 8 125,277,045 (GRCm39) missense probably damaging 1.00
R6518:Cog2 UTSW 8 125,253,842 (GRCm39) nonsense probably null
R6558:Cog2 UTSW 8 125,276,971 (GRCm39) missense probably damaging 1.00
R6717:Cog2 UTSW 8 125,252,488 (GRCm39) missense probably damaging 1.00
R6902:Cog2 UTSW 8 125,273,430 (GRCm39) missense probably damaging 1.00
R6914:Cog2 UTSW 8 125,271,875 (GRCm39) missense probably benign 0.00
R6942:Cog2 UTSW 8 125,271,875 (GRCm39) missense probably benign 0.00
R7103:Cog2 UTSW 8 125,267,853 (GRCm39) critical splice donor site probably null
R7274:Cog2 UTSW 8 125,262,258 (GRCm39) missense possibly damaging 0.71
R7641:Cog2 UTSW 8 125,264,621 (GRCm39) missense probably damaging 0.96
R8559:Cog2 UTSW 8 125,269,647 (GRCm39) missense probably benign 0.25
R9190:Cog2 UTSW 8 125,260,058 (GRCm39) missense probably damaging 1.00
R9307:Cog2 UTSW 8 125,253,837 (GRCm39) critical splice acceptor site probably null
R9629:Cog2 UTSW 8 125,260,125 (GRCm39) missense possibly damaging 0.67
X0026:Cog2 UTSW 8 125,272,759 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AGCGAAGAGTTCCACAACTG -3'
(R):5'- TCCAAGTATCATATCCACACTTGAGAG -3'

Sequencing Primer
(F):5'- GAAGAGTTCCACAACTGGTTCCTG -3'
(R):5'- CATATCCACACTTGAGAGAAGCAGTG -3'
Posted On 2019-11-12