Incidental Mutation 'R7674:Olfr870'
ID592383
Institutional Source Beutler Lab
Gene Symbol Olfr870
Ensembl Gene ENSMUSG00000066899
Gene Nameolfactory receptor 870
SynonymsGA_x6K02T2PVTD-13912679-13911744, MOR141-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R7674 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location20168533-20174057 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20171253 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 106 (L106P)
Ref Sequence ENSEMBL: ENSMUSP00000150084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086476] [ENSMUST00000215984]
Predicted Effect possibly damaging
Transcript: ENSMUST00000086476
AA Change: L106P

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000091405
Gene: ENSMUSG00000066899
AA Change: L106P

DomainStartEndE-ValueType
Pfam:7tm_4 31 311 1.8e-52 PFAM
Pfam:7TM_GPCR_Srsx 35 304 1.8e-7 PFAM
Pfam:7tm_1 41 290 3.9e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215984
AA Change: L106P

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T G 3: 108,462,991 R698S probably damaging Het
Abca6 T A 11: 110,219,297 I607F probably damaging Het
Abcc4 A T 14: 118,611,487 D559E probably damaging Het
Abl1 T C 2: 31,689,829 V8A possibly damaging Het
Alkal1 A T 1: 6,389,488 Y96F probably damaging Het
Asb3 T A 11: 31,081,435 C352S possibly damaging Het
B4galnt3 G T 6: 120,215,205 D523E probably benign Het
Cadps C A 14: 12,411,581 E1258D probably damaging Het
Carmil2 A T 8: 105,697,286 Q1257L possibly damaging Het
Cars A G 7: 143,587,103 probably null Het
Ccdc88c G T 12: 100,945,232 A781E probably benign Het
Ccr10 A T 11: 101,174,649 D18E probably benign Het
Cdcp1 C A 9: 123,216,006 probably benign Het
Ces5a C A 8: 93,514,269 R400L probably damaging Het
Clcn6 C T 4: 148,012,694 V636M probably damaging Het
Cluh T A 11: 74,667,720 L1206H probably damaging Het
Cog2 C A 8: 124,537,882 N333K probably damaging Het
Dnah14 A T 1: 181,707,533 I2355L probably benign Het
Dok4 T C 8: 94,866,562 Y165C probably damaging Het
Dpy19l3 A C 7: 35,695,309 D601E probably damaging Het
Egr3 G A 14: 70,078,077 probably null Het
Evpl T C 11: 116,222,568 K1432R probably benign Het
Fbxw8 A T 5: 118,124,971 C214* probably null Het
Gm13088 T A 4: 143,655,605 K174* probably null Het
Gm45861 A C 8: 27,540,119 Y821S unknown Het
Gm5519 G C 19: 33,825,028 G157A probably benign Het
Gys1 T C 7: 45,455,071 S641P probably damaging Het
Ighv6-6 T A 12: 114,435,217 I10L probably benign Het
Ikbkap T C 4: 56,792,075 Q231R probably damaging Het
Jmy C T 13: 93,442,599 R675Q probably damaging Het
Kif14 C T 1: 136,468,820 T288I probably damaging Het
Kpna3 A T 14: 61,367,637 N520K probably benign Het
Lonp2 A T 8: 86,665,758 Q484L probably benign Het
Lrp1b T A 2: 42,652,909 probably benign Het
Mpeg1 A T 19: 12,461,387 M70L probably benign Het
Msh3 C A 13: 92,212,503 V1074L probably benign Het
Muc6 A T 7: 141,639,825 L1645Q unknown Het
Nipbl C T 15: 8,293,101 V2609I probably benign Het
Nucks1 C A 1: 131,931,106 T202N probably benign Het
Olfr1024 A C 2: 85,904,536 F173V probably damaging Het
Olfr119 A G 17: 37,700,682 N4S probably benign Het
Olfr1262 A T 2: 90,003,045 Y213F probably damaging Het
Olfr1509 A G 14: 52,450,442 T10A probably benign Het
Plekha2 A G 8: 25,057,298 S257P probably damaging Het
Pnlip G C 19: 58,675,154 G187A possibly damaging Het
Rasgrf2 C T 13: 92,131,406 S30N possibly damaging Het
Rho G T 6: 115,932,333 C110F probably damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Slc2a12 A G 10: 22,693,994 D528G probably damaging Het
Sorcs2 G A 5: 36,397,952 R32C probably damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Srp72 A T 5: 76,974,826 N35Y probably damaging Het
Tm2d2 C A 8: 25,018,264 Y141* probably null Het
Tor3a G A 1: 156,655,908 H315Y possibly damaging Het
Usp17la A T 7: 104,861,447 K420* probably null Het
Vmn2r26 T C 6: 124,039,362 W262R probably benign Het
Yipf7 A T 5: 69,519,229 V189D probably damaging Het
Zan T A 5: 137,467,108 M462L possibly damaging Het
Zc3h18 AGG AG 8: 122,383,556 probably null Het
Zfp930 A T 8: 69,228,685 H344L probably damaging Het
Other mutations in Olfr870
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Olfr870 APN 9 20171530 missense probably damaging 1.00
IGL01809:Olfr870 APN 9 20171295 missense probably damaging 1.00
IGL02130:Olfr870 APN 9 20171358 missense probably damaging 0.96
IGL03062:Olfr870 APN 9 20171167 missense probably damaging 1.00
IGL03133:Olfr870 APN 9 20170713 missense probably damaging 1.00
R0110:Olfr870 UTSW 9 20171265 missense probably benign 0.04
R0350:Olfr870 UTSW 9 20170736 nonsense probably null
R0417:Olfr870 UTSW 9 20171214 missense probably damaging 1.00
R0450:Olfr870 UTSW 9 20171265 missense probably benign 0.04
R0469:Olfr870 UTSW 9 20171265 missense probably benign 0.04
R1169:Olfr870 UTSW 9 20171058 missense probably benign 0.04
R1728:Olfr870 UTSW 9 20170913 nonsense probably null
R1729:Olfr870 UTSW 9 20170913 nonsense probably null
R1776:Olfr870 UTSW 9 20170809 missense probably benign 0.16
R1784:Olfr870 UTSW 9 20170913 nonsense probably null
R1914:Olfr870 UTSW 9 20171028 missense probably benign 0.22
R1915:Olfr870 UTSW 9 20171028 missense probably benign 0.22
R1929:Olfr870 UTSW 9 20171409 missense possibly damaging 0.73
R1936:Olfr870 UTSW 9 20171181 missense probably damaging 1.00
R2066:Olfr870 UTSW 9 20171554 missense probably benign 0.01
R2137:Olfr870 UTSW 9 20171167 missense probably damaging 1.00
R2221:Olfr870 UTSW 9 20171092 missense possibly damaging 0.86
R2270:Olfr870 UTSW 9 20171409 missense possibly damaging 0.73
R2271:Olfr870 UTSW 9 20171409 missense possibly damaging 0.73
R2272:Olfr870 UTSW 9 20171409 missense possibly damaging 0.73
R2509:Olfr870 UTSW 9 20171229 missense probably damaging 1.00
R2939:Olfr870 UTSW 9 20170765 missense probably benign
R2940:Olfr870 UTSW 9 20170765 missense probably benign
R3081:Olfr870 UTSW 9 20170765 missense probably benign
R4579:Olfr870 UTSW 9 20171114 missense probably damaging 1.00
R4667:Olfr870 UTSW 9 20171098 missense probably benign 0.04
R5681:Olfr870 UTSW 9 20170795 missense probably damaging 1.00
R5686:Olfr870 UTSW 9 20170969 missense possibly damaging 0.75
R5857:Olfr870 UTSW 9 20171239 missense probably damaging 1.00
R6561:Olfr870 UTSW 9 20170777 missense probably benign 0.01
R6842:Olfr870 UTSW 9 20171253 missense possibly damaging 0.95
R6987:Olfr870 UTSW 9 20170834 missense probably benign 0.03
R7641:Olfr870 UTSW 9 20171253 missense possibly damaging 0.95
R8375:Olfr870 UTSW 9 20170741 missense probably benign 0.04
R8445:Olfr870 UTSW 9 20171098 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTACAGAAGGACAACCGC -3'
(R):5'- CGCTGTGCTTGGGAATCTTC -3'

Sequencing Primer
(F):5'- GCAGCATCAATAGACTCTGTATCAG -3'
(R):5'- ATTCTGGCCGTCAGCATTG -3'
Posted On2019-11-12