Incidental Mutation 'R7674:Asb3'
ID592385
Institutional Source Beutler Lab
Gene Symbol Asb3
Ensembl Gene ENSMUSG00000020305
Gene Nameankyrin repeat and SOCS box-containing 3
Synonyms2400011J03Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.277) question?
Stock #R7674 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location30885416-31102704 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31081435 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 352 (C352S)
Ref Sequence ENSEMBL: ENSMUSP00000020551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020551] [ENSMUST00000117883] [ENSMUST00000137306] [ENSMUST00000203878]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020551
AA Change: C352S

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020551
Gene: ENSMUSG00000020305
AA Change: C352S

DomainStartEndE-ValueType
ANK 9 38 5.29e0 SMART
ANK 42 71 1.23e0 SMART
ANK 78 107 7.3e-3 SMART
ANK 111 140 2.66e-5 SMART
ANK 145 174 2.73e-2 SMART
ANK 178 207 2.81e-4 SMART
ANK 211 240 1.88e-5 SMART
ANK 246 276 1.6e2 SMART
ANK 279 308 1.9e-1 SMART
ANK 315 346 1.17e2 SMART
SOCS_box 460 502 2.1e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117883
AA Change: C352S

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113072
Gene: ENSMUSG00000020305
AA Change: C352S

DomainStartEndE-ValueType
ANK 9 38 5.29e0 SMART
ANK 42 71 1.23e0 SMART
ANK 78 107 7.3e-3 SMART
ANK 111 140 2.66e-5 SMART
ANK 145 174 2.73e-2 SMART
ANK 178 207 2.81e-4 SMART
ANK 211 240 1.88e-5 SMART
ANK 246 276 1.6e2 SMART
ANK 279 308 1.9e-1 SMART
ANK 315 346 1.17e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137306
SMART Domains Protein: ENSMUSP00000114692
Gene: ENSMUSG00000020305

DomainStartEndE-ValueType
ANK 9 38 5.29e0 SMART
ANK 42 71 4.3e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000203878
AA Change: C391S

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144900
Gene: ENSMUSG00000020305
AA Change: C391S

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
ANK 48 77 3.5e-2 SMART
ANK 81 110 8e-3 SMART
ANK 117 146 4.8e-5 SMART
ANK 150 179 1.7e-7 SMART
ANK 184 213 1.8e-4 SMART
ANK 217 246 1.8e-6 SMART
ANK 250 279 1.2e-7 SMART
ANK 285 315 1.1e0 SMART
ANK 318 347 1.2e-3 SMART
ANK 354 385 7.7e-1 SMART
SOCS 493 542 2.8e-4 SMART
SOCS_box 499 541 1.6e-17 SMART
Meta Mutation Damage Score 0.2128 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T G 3: 108,462,991 R698S probably damaging Het
Abca6 T A 11: 110,219,297 I607F probably damaging Het
Abcc4 A T 14: 118,611,487 D559E probably damaging Het
Abl1 T C 2: 31,689,829 V8A possibly damaging Het
Alkal1 A T 1: 6,389,488 Y96F probably damaging Het
B4galnt3 G T 6: 120,215,205 D523E probably benign Het
Cadps C A 14: 12,411,581 E1258D probably damaging Het
Carmil2 A T 8: 105,697,286 Q1257L possibly damaging Het
Cars A G 7: 143,587,103 probably null Het
Ccdc88c G T 12: 100,945,232 A781E probably benign Het
Ccr10 A T 11: 101,174,649 D18E probably benign Het
Cdcp1 C A 9: 123,216,006 probably benign Het
Ces5a C A 8: 93,514,269 R400L probably damaging Het
Clcn6 C T 4: 148,012,694 V636M probably damaging Het
Cluh T A 11: 74,667,720 L1206H probably damaging Het
Cog2 C A 8: 124,537,882 N333K probably damaging Het
Dnah14 A T 1: 181,707,533 I2355L probably benign Het
Dok4 T C 8: 94,866,562 Y165C probably damaging Het
Dpy19l3 A C 7: 35,695,309 D601E probably damaging Het
Egr3 G A 14: 70,078,077 probably null Het
Evpl T C 11: 116,222,568 K1432R probably benign Het
Fbxw8 A T 5: 118,124,971 C214* probably null Het
Gm13088 T A 4: 143,655,605 K174* probably null Het
Gm45861 A C 8: 27,540,119 Y821S unknown Het
Gm5519 G C 19: 33,825,028 G157A probably benign Het
Gys1 T C 7: 45,455,071 S641P probably damaging Het
Ighv6-6 T A 12: 114,435,217 I10L probably benign Het
Ikbkap T C 4: 56,792,075 Q231R probably damaging Het
Jmy C T 13: 93,442,599 R675Q probably damaging Het
Kif14 C T 1: 136,468,820 T288I probably damaging Het
Kpna3 A T 14: 61,367,637 N520K probably benign Het
Lonp2 A T 8: 86,665,758 Q484L probably benign Het
Lrp1b T A 2: 42,652,909 probably benign Het
Mpeg1 A T 19: 12,461,387 M70L probably benign Het
Msh3 C A 13: 92,212,503 V1074L probably benign Het
Muc6 A T 7: 141,639,825 L1645Q unknown Het
Nipbl C T 15: 8,293,101 V2609I probably benign Het
Nucks1 C A 1: 131,931,106 T202N probably benign Het
Olfr1024 A C 2: 85,904,536 F173V probably damaging Het
Olfr119 A G 17: 37,700,682 N4S probably benign Het
Olfr1262 A T 2: 90,003,045 Y213F probably damaging Het
Olfr1509 A G 14: 52,450,442 T10A probably benign Het
Olfr870 A G 9: 20,171,253 L106P possibly damaging Het
Plekha2 A G 8: 25,057,298 S257P probably damaging Het
Pnlip G C 19: 58,675,154 G187A possibly damaging Het
Rasgrf2 C T 13: 92,131,406 S30N possibly damaging Het
Rho G T 6: 115,932,333 C110F probably damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Slc2a12 A G 10: 22,693,994 D528G probably damaging Het
Sorcs2 G A 5: 36,397,952 R32C probably damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Srp72 A T 5: 76,974,826 N35Y probably damaging Het
Tm2d2 C A 8: 25,018,264 Y141* probably null Het
Tor3a G A 1: 156,655,908 H315Y possibly damaging Het
Usp17la A T 7: 104,861,447 K420* probably null Het
Vmn2r26 T C 6: 124,039,362 W262R probably benign Het
Yipf7 A T 5: 69,519,229 V189D probably damaging Het
Zan T A 5: 137,467,108 M462L possibly damaging Het
Zc3h18 AGG AG 8: 122,383,556 probably null Het
Zfp930 A T 8: 69,228,685 H344L probably damaging Het
Other mutations in Asb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02879:Asb3 APN 11 31101067 missense probably damaging 1.00
IGL02932:Asb3 APN 11 31029067 critical splice donor site probably null
Kickbox UTSW 11 30998326 missense probably damaging 1.00
low_blow UTSW 11 30998348 nonsense probably null
Octagon UTSW 11 30998321 missense probably benign 0.34
penalty UTSW 11 31081357 splice site probably null
sixpack UTSW 11 31085143 missense probably benign
R0573:Asb3 UTSW 11 31061406 missense probably damaging 0.99
R1395:Asb3 UTSW 11 31101032 splice site probably benign
R1545:Asb3 UTSW 11 31056217 missense probably benign 0.00
R2108:Asb3 UTSW 11 31081355 splice site probably null
R2364:Asb3 UTSW 11 31101192 missense probably benign 0.01
R4527:Asb3 UTSW 11 31058933 missense probably benign 0.30
R5019:Asb3 UTSW 11 31081415 missense possibly damaging 0.95
R5176:Asb3 UTSW 11 31081357 splice site probably null
R5344:Asb3 UTSW 11 31101114 missense probably benign 0.01
R5734:Asb3 UTSW 11 31029021 missense probably damaging 1.00
R6251:Asb3 UTSW 11 31055559 missense probably damaging 1.00
R6265:Asb3 UTSW 11 31085143 missense probably benign
R6747:Asb3 UTSW 11 31081493 missense probably benign 0.01
R6827:Asb3 UTSW 11 31101211 missense probably benign 0.00
R6928:Asb3 UTSW 11 30998326 missense probably damaging 1.00
R7048:Asb3 UTSW 11 31101121 missense probably damaging 1.00
R7087:Asb3 UTSW 11 30998321 missense probably benign 0.34
R7135:Asb3 UTSW 11 30998501 nonsense probably null
R7165:Asb3 UTSW 11 31029029 missense probably damaging 0.99
R7200:Asb3 UTSW 11 30998348 nonsense probably null
R7265:Asb3 UTSW 11 30998495 missense probably benign 0.02
R7509:Asb3 UTSW 11 30998507 missense probably benign 0.12
R8029:Asb3 UTSW 11 31101180 nonsense probably null
R8034:Asb3 UTSW 11 31081554 nonsense probably null
R8061:Asb3 UTSW 11 30998447 missense probably damaging 1.00
RF016:Asb3 UTSW 11 31061407 missense possibly damaging 0.95
X0024:Asb3 UTSW 11 31058950 missense probably damaging 0.97
Z1177:Asb3 UTSW 11 31058965 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- GCATGTAAAAGCCATTGGTTATACC -3'
(R):5'- CAGAATCAATGGGTCAAATCCAG -3'

Sequencing Primer
(F):5'- ACCAAGTGCTATTTTCATTTCCAG -3'
(R):5'- TGGGTCAAATCCAGCAAGC -3'
Posted On2019-11-12