Incidental Mutation 'R7674:Ccr10'
ID592387
Institutional Source Beutler Lab
Gene Symbol Ccr10
Ensembl Gene ENSMUSG00000044052
Gene Namechemokine (C-C motif) receptor 10
SynonymsCmkbr9, GPR2, CCR10
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7674 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location101172997-101175443 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 101174649 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 18 (D18E)
Ref Sequence ENSEMBL: ENSMUSP00000062588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043397] [ENSMUST00000062759] [ENSMUST00000103109] [ENSMUST00000123864] [ENSMUST00000129895] [ENSMUST00000164474]
Predicted Effect probably benign
Transcript: ENSMUST00000043397
SMART Domains Protein: ENSMUSP00000046044
Gene: ENSMUSG00000035172

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 23 40 N/A INTRINSIC
PH 96 201 1.9e-5 SMART
low complexity region 241 251 N/A INTRINSIC
Pfam:MyTH4 285 398 4.2e-21 PFAM
B41 400 664 2.91e-4 SMART
low complexity region 750 766 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000062759
AA Change: D18E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000062588
Gene: ENSMUSG00000044052
AA Change: D18E

DomainStartEndE-ValueType
Pfam:7tm_1 58 310 4.8e-43 PFAM
low complexity region 313 329 N/A INTRINSIC
low complexity region 336 349 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103109
SMART Domains Protein: ENSMUSP00000099398
Gene: ENSMUSG00000017167

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
FA58C 25 169 7.49e-36 SMART
LamG 196 333 2.86e-32 SMART
LamG 382 516 3.49e-27 SMART
EGF 544 578 2.28e0 SMART
Blast:FBG 580 777 1e-133 BLAST
LamG 806 940 1.95e-25 SMART
EGF_like 961 997 6.03e1 SMART
low complexity region 1032 1044 N/A INTRINSIC
low complexity region 1047 1058 N/A INTRINSIC
low complexity region 1063 1078 N/A INTRINSIC
LamG 1081 1219 2.59e-30 SMART
4.1m 1305 1323 7.85e-7 SMART
low complexity region 1333 1370 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123864
SMART Domains Protein: ENSMUSP00000120865
Gene: ENSMUSG00000035172

DomainStartEndE-ValueType
PH 95 200 1.9e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129895
SMART Domains Protein: ENSMUSP00000137841
Gene: ENSMUSG00000035172

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 23 40 N/A INTRINSIC
PH 96 201 1.9e-5 SMART
low complexity region 241 251 N/A INTRINSIC
Pfam:MyTH4 281 399 2.7e-16 PFAM
B41 400 664 5.17e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164474
SMART Domains Protein: ENSMUSP00000127088
Gene: ENSMUSG00000035172

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 23 40 N/A INTRINSIC
PH 96 201 1.9e-5 SMART
low complexity region 241 251 N/A INTRINSIC
Pfam:MyTH4 281 399 3.3e-16 PFAM
B41 400 661 6.14e-4 SMART
low complexity region 747 763 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Chemokines are a group of small (approximately 8 to 14 kD), mostly basic, structurally related molecules that regulate cell trafficking of various types of leukocytes through interactions with a subset of 7-transmembrane, G protein-coupled receptors. Chemokines also play fundamental roles in the development, homeostasis, and function of the immune system, and they have effects on cells of the central nervous system as well as on endothelial cells involved in angiogenesis or angiostasis. Chemokines are divided into 2 major subfamilies, CXC and CC, based on the arrangement of the first 2 of the 4 conserved cysteine residues; the 2 cysteines are separated by a single amino acid in CXC chemokines and are adjacent in CC chemokines. CCR10 is the receptor for CCL27 (SCYA27; MIM 604833); CCR10-CCL27 interactions are involved in T cell-mediated skin inflammation (Homey et al., 2002 [PubMed 11821900]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for null mutation are viable and fertile, without any detectable neurological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T G 3: 108,462,991 R698S probably damaging Het
Abca6 T A 11: 110,219,297 I607F probably damaging Het
Abcc4 A T 14: 118,611,487 D559E probably damaging Het
Abl1 T C 2: 31,689,829 V8A possibly damaging Het
Alkal1 A T 1: 6,389,488 Y96F probably damaging Het
Asb3 T A 11: 31,081,435 C352S possibly damaging Het
B4galnt3 G T 6: 120,215,205 D523E probably benign Het
Cadps C A 14: 12,411,581 E1258D probably damaging Het
Carmil2 A T 8: 105,697,286 Q1257L possibly damaging Het
Cars A G 7: 143,587,103 probably null Het
Ccdc88c G T 12: 100,945,232 A781E probably benign Het
Cdcp1 C A 9: 123,216,006 probably benign Het
Ces5a C A 8: 93,514,269 R400L probably damaging Het
Clcn6 C T 4: 148,012,694 V636M probably damaging Het
Cluh T A 11: 74,667,720 L1206H probably damaging Het
Cog2 C A 8: 124,537,882 N333K probably damaging Het
Dnah14 A T 1: 181,707,533 I2355L probably benign Het
Dok4 T C 8: 94,866,562 Y165C probably damaging Het
Dpy19l3 A C 7: 35,695,309 D601E probably damaging Het
Egr3 G A 14: 70,078,077 probably null Het
Evpl T C 11: 116,222,568 K1432R probably benign Het
Fbxw8 A T 5: 118,124,971 C214* probably null Het
Gm13088 T A 4: 143,655,605 K174* probably null Het
Gm45861 A C 8: 27,540,119 Y821S unknown Het
Gm5519 G C 19: 33,825,028 G157A probably benign Het
Gys1 T C 7: 45,455,071 S641P probably damaging Het
Ighv6-6 T A 12: 114,435,217 I10L probably benign Het
Ikbkap T C 4: 56,792,075 Q231R probably damaging Het
Jmy C T 13: 93,442,599 R675Q probably damaging Het
Kif14 C T 1: 136,468,820 T288I probably damaging Het
Kpna3 A T 14: 61,367,637 N520K probably benign Het
Lonp2 A T 8: 86,665,758 Q484L probably benign Het
Lrp1b T A 2: 42,652,909 probably benign Het
Mpeg1 A T 19: 12,461,387 M70L probably benign Het
Msh3 C A 13: 92,212,503 V1074L probably benign Het
Muc6 A T 7: 141,639,825 L1645Q unknown Het
Nipbl C T 15: 8,293,101 V2609I probably benign Het
Nucks1 C A 1: 131,931,106 T202N probably benign Het
Olfr1024 A C 2: 85,904,536 F173V probably damaging Het
Olfr119 A G 17: 37,700,682 N4S probably benign Het
Olfr1262 A T 2: 90,003,045 Y213F probably damaging Het
Olfr1509 A G 14: 52,450,442 T10A probably benign Het
Olfr870 A G 9: 20,171,253 L106P possibly damaging Het
Plekha2 A G 8: 25,057,298 S257P probably damaging Het
Pnlip G C 19: 58,675,154 G187A possibly damaging Het
Rasgrf2 C T 13: 92,131,406 S30N possibly damaging Het
Rho G T 6: 115,932,333 C110F probably damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Slc2a12 A G 10: 22,693,994 D528G probably damaging Het
Sorcs2 G A 5: 36,397,952 R32C probably damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Srp72 A T 5: 76,974,826 N35Y probably damaging Het
Tm2d2 C A 8: 25,018,264 Y141* probably null Het
Tor3a G A 1: 156,655,908 H315Y possibly damaging Het
Usp17la A T 7: 104,861,447 K420* probably null Het
Vmn2r26 T C 6: 124,039,362 W262R probably benign Het
Yipf7 A T 5: 69,519,229 V189D probably damaging Het
Zan T A 5: 137,467,108 M462L possibly damaging Het
Zc3h18 AGG AG 8: 122,383,556 probably null Het
Zfp930 A T 8: 69,228,685 H344L probably damaging Het
Other mutations in Ccr10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02887:Ccr10 APN 11 101174666 missense probably benign 0.01
R1523:Ccr10 UTSW 11 101173675 missense probably damaging 0.98
R1696:Ccr10 UTSW 11 101174384 missense probably benign 0.25
R5275:Ccr10 UTSW 11 101174285 missense possibly damaging 0.92
R5295:Ccr10 UTSW 11 101174285 missense possibly damaging 0.92
R5418:Ccr10 UTSW 11 101174078 missense probably benign 0.16
R6219:Ccr10 UTSW 11 101174549 missense possibly damaging 0.85
R7161:Ccr10 UTSW 11 101174278 missense probably benign 0.02
Z1176:Ccr10 UTSW 11 101174323 missense probably damaging 1.00
Z1176:Ccr10 UTSW 11 101174340 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCAATAAAAGGTCAGCCAGGGC -3'
(R):5'- GGGCACACTAGCAAGAATCTG -3'

Sequencing Primer
(F):5'- TCAGCCAGGGCCAACTG -3'
(R):5'- CACACTAGCAAGAATCTGGAGAG -3'
Posted On2019-11-12