Mutagenetix > Incidental Mutation

Incidental Mutation 'R7674:Rasgrf2'

592392

Institutional Source

Beutler Lab

Gene Symbol

Rasgrf2

Ensembl Gene

ENSMUSG00000021708

Gene Name

RAS protein-specific guanine nucleotide-releasing factor 2

Synonyms

Grf2, 6330417G04Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.170) question?

Stock #

R7674 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

91880400-92131656 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 92131406 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Asparagine at position 30 (S30N)

Ref Sequence

ENSEMBL: ENSMUSP00000096930 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099326] [ENSMUST00000146492] [ENSMUST00000216219]

AlphaFold

P70392

Predicted Effect

possibly damaging
Transcript: ENSMUST00000099326
AA Change: S30N

PolyPhen 2 Score 0.649 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000096930
Gene: ENSMUSG00000021708
AA Change: S30N

Domain	Start	End	E-Value	Type
PH	23	135	1.29e-16	SMART
IQ	204	226	1.3e0	SMART
RhoGEF	247	428	2.2e-51	SMART
RasGEFN	633	775	9.35e-15	SMART
RasGEFN	786	923	6.04e-9	SMART
RasGEF	949	1186	2.97e-112	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000146492
AA Change: S30N

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000116203
Gene: ENSMUSG00000021708
AA Change: S30N

Domain	Start	End	E-Value	Type
PH	23	135	1.29e-16	SMART
IQ	204	226	1.3e0	SMART
Pfam:RhoGEF	247	387	1.2e-24	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000216219
AA Change: S30N

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RAS GTPases cycle between an inactive GDP-bound state and an active GTP-bound state. This gene encodes a calcium-regulated nucleotide exchange factor activating both RAS and RAS-related protein, RAC1, through the exchange of bound GDP for GTP, thereby, coordinating the signaling of distinct mitogen-activated protein kinase pathways. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit decreased Il2 and TNF-alpha production in stimulated T cells. Mice homozygous for mutations in both Rasgrf1 and Rasgrf2 exhibit no additional abnormalities than those observed in the Rasgrf1 mutant mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5330417C22Rik	T	G	3: 108,462,991	R698S	probably damaging	Het
Abca6	T	A	11: 110,219,297	I607F	probably damaging	Het
Abcc4	A	T	14: 118,611,487	D559E	probably damaging	Het
Abl1	T	C	2: 31,689,829	V8A	possibly damaging	Het
Alkal1	A	T	1: 6,389,488	Y96F	probably damaging	Het
Asb3	T	A	11: 31,081,435	C352S	possibly damaging	Het
B4galnt3	G	T	6: 120,215,205	D523E	probably benign	Het
Cadps	C	A	14: 12,411,581	E1258D	probably damaging	Het
Carmil2	A	T	8: 105,697,286	Q1257L	possibly damaging	Het
Cars	A	G	7: 143,587,103		probably null	Het
Ccdc88c	G	T	12: 100,945,232	A781E	probably benign	Het
Ccr10	A	T	11: 101,174,649	D18E	probably benign	Het
Cdcp1	C	A	9: 123,216,006		probably benign	Het
Ces5a	C	A	8: 93,514,269	R400L	probably damaging	Het
Clcn6	C	T	4: 148,012,694	V636M	probably damaging	Het
Cluh	T	A	11: 74,667,720	L1206H	probably damaging	Het
Cog2	C	A	8: 124,537,882	N333K	probably damaging	Het
Dnah14	A	T	1: 181,707,533	I2355L	probably benign	Het
Dok4	T	C	8: 94,866,562	Y165C	probably damaging	Het
Dpy19l3	A	C	7: 35,695,309	D601E	probably damaging	Het
Egr3	G	A	14: 70,078,077		probably null	Het
Evpl	T	C	11: 116,222,568	K1432R	probably benign	Het
Fbxw8	A	T	5: 118,124,971	C214*	probably null	Het
Gm13088	T	A	4: 143,655,605	K174*	probably null	Het
Gm45861	A	C	8: 27,540,119	Y821S	unknown	Het
Gm5519	G	C	19: 33,825,028	G157A	probably benign	Het
Gys1	T	C	7: 45,455,071	S641P	probably damaging	Het
Ighv6-6	T	A	12: 114,435,217	I10L	probably benign	Het
Ikbkap	T	C	4: 56,792,075	Q231R	probably damaging	Het
Jmy	C	T	13: 93,442,599	R675Q	probably damaging	Het
Kif14	C	T	1: 136,468,820	T288I	probably damaging	Het
Kpna3	A	T	14: 61,367,637	N520K	probably benign	Het
Lonp2	A	T	8: 86,665,758	Q484L	probably benign	Het
Lrp1b	T	A	2: 42,652,909		probably benign	Het
Mpeg1	A	T	19: 12,461,387	M70L	probably benign	Het
Msh3	C	A	13: 92,212,503	V1074L	probably benign	Het
Muc6	A	T	7: 141,639,825	L1645Q	unknown	Het
Nipbl	C	T	15: 8,293,101	V2609I	probably benign	Het
Nucks1	C	A	1: 131,931,106	T202N	probably benign	Het
Olfr1024	A	C	2: 85,904,536	F173V	probably damaging	Het
Olfr119	A	G	17: 37,700,682	N4S	probably benign	Het
Olfr1262	A	T	2: 90,003,045	Y213F	probably damaging	Het
Olfr1509	A	G	14: 52,450,442	T10A	probably benign	Het
Olfr870	A	G	9: 20,171,253	L106P	possibly damaging	Het
Plekha2	A	G	8: 25,057,298	S257P	probably damaging	Het
Pnlip	G	C	19: 58,675,154	G187A	possibly damaging	Het
Rho	G	T	6: 115,932,333	C110F	probably damaging	Het
Selplg	GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT	GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT	5: 113,819,695		probably benign	Het
Slc2a12	A	G	10: 22,693,994	D528G	probably damaging	Het
Sorcs2	G	A	5: 36,397,952	R32C	probably damaging	Het
Sp110	G	A	1: 85,579,092	R417C	probably benign	Het
Srp72	A	T	5: 76,974,826	N35Y	probably damaging	Het
Tm2d2	C	A	8: 25,018,264	Y141*	probably null	Het
Tor3a	G	A	1: 156,655,908	H315Y	possibly damaging	Het
Usp17la	A	T	7: 104,861,447	K420*	probably null	Het
Vmn2r26	T	C	6: 124,039,362	W262R	probably benign	Het
Yipf7	A	T	5: 69,519,229	V189D	probably damaging	Het
Zan	T	A	5: 137,467,108	M462L	possibly damaging	Het
Zc3h18	AGG	AG	8: 122,383,556		probably null	Het
Zfp930	A	T	8: 69,228,685	H344L	probably damaging	Het

Other mutations in Rasgrf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01308:Rasgrf2	APN	13	92022917	splice site	probably benign
IGL01358:Rasgrf2	APN	13	91982630	missense	probably benign	0.23
IGL01666:Rasgrf2	APN	13	92038210	missense	probably damaging	1.00
IGL01930:Rasgrf2	APN	13	91982738	missense	probably damaging	0.98
IGL02230:Rasgrf2	APN	13	91988026	missense	probably damaging	1.00
IGL02630:Rasgrf2	APN	13	92131392	missense	probably damaging	1.00
IGL02690:Rasgrf2	APN	13	92030765	missense	probably damaging	1.00
IGL02943:Rasgrf2	APN	13	91983633	missense	probably damaging	1.00
IGL03067:Rasgrf2	APN	13	92022905	missense	probably damaging	0.97
IGL03342:Rasgrf2	APN	13	91987979	missense	probably damaging	1.00
IGL03405:Rasgrf2	APN	13	91896051	missense	probably damaging	1.00
R0620:Rasgrf2	UTSW	13	91919817	splice site	probably benign
R0632:Rasgrf2	UTSW	13	91972274	missense	probably benign	0.00
R0894:Rasgrf2	UTSW	13	91982771	missense	probably damaging	1.00
R1354:Rasgrf2	UTSW	13	92028666	missense	probably damaging	1.00
R1400:Rasgrf2	UTSW	13	91887689	missense	probably damaging	1.00
R1437:Rasgrf2	UTSW	13	92030888	missense	probably damaging	1.00
R1443:Rasgrf2	UTSW	13	91983676	missense	probably damaging	1.00
R1522:Rasgrf2	UTSW	13	91896086	missense	probably benign	0.00
R1553:Rasgrf2	UTSW	13	91890664	missense	probably damaging	1.00
R1613:Rasgrf2	UTSW	13	91902621	missense	probably damaging	1.00
R1883:Rasgrf2	UTSW	13	91969030	missense	probably benign
R1934:Rasgrf2	UTSW	13	91983706	splice site	probably null
R1990:Rasgrf2	UTSW	13	92035965	missense	probably damaging	1.00
R2037:Rasgrf2	UTSW	13	91902629	missense	probably damaging	0.99
R2043:Rasgrf2	UTSW	13	92030843	missense	possibly damaging	0.91
R2135:Rasgrf2	UTSW	13	91972255	missense	probably benign
R2193:Rasgrf2	UTSW	13	92023713	splice site	probably null
R2406:Rasgrf2	UTSW	13	91972240	missense	probably benign
R3055:Rasgrf2	UTSW	13	92029075	missense	probably damaging	1.00
R3916:Rasgrf2	UTSW	13	92030788	missense	probably damaging	1.00
R3954:Rasgrf2	UTSW	13	91982855	missense	probably damaging	0.98
R3955:Rasgrf2	UTSW	13	91982855	missense	probably damaging	0.98
R3956:Rasgrf2	UTSW	13	91982855	missense	probably damaging	0.98
R4133:Rasgrf2	UTSW	13	91982654	missense	possibly damaging	0.59
R4177:Rasgrf2	UTSW	13	91890598	missense	probably damaging	1.00
R4178:Rasgrf2	UTSW	13	91890598	missense	probably damaging	1.00
R4357:Rasgrf2	UTSW	13	91890677	missense	probably damaging	1.00
R4358:Rasgrf2	UTSW	13	91890677	missense	probably damaging	1.00
R4359:Rasgrf2	UTSW	13	91890677	missense	probably damaging	1.00
R4439:Rasgrf2	UTSW	13	91983678	missense	possibly damaging	0.95
R4440:Rasgrf2	UTSW	13	91983678	missense	possibly damaging	0.95
R4441:Rasgrf2	UTSW	13	91983678	missense	possibly damaging	0.95
R4564:Rasgrf2	UTSW	13	91885654	nonsense	probably null
R4576:Rasgrf2	UTSW	13	91896410	missense	possibly damaging	0.58
R4590:Rasgrf2	UTSW	13	92038281	missense	probably damaging	1.00
R4718:Rasgrf2	UTSW	13	91990830	critical splice donor site	probably null
R4778:Rasgrf2	UTSW	13	91983661	missense	probably damaging	0.99
R4790:Rasgrf2	UTSW	13	91988016	missense	probably damaging	1.00
R4808:Rasgrf2	UTSW	13	92023682	missense	probably damaging	1.00
R5151:Rasgrf2	UTSW	13	91896036	missense	probably damaging	1.00
R5286:Rasgrf2	UTSW	13	92131433	missense	possibly damaging	0.94
R5902:Rasgrf2	UTSW	13	91919892	missense	probably damaging	1.00
R6180:Rasgrf2	UTSW	13	92029101	missense	probably damaging	1.00
R6264:Rasgrf2	UTSW	13	92030785	missense	probably damaging	1.00
R6369:Rasgrf2	UTSW	13	92131446	missense	probably benign
R6428:Rasgrf2	UTSW	13	91987981	missense	probably damaging	1.00
R6595:Rasgrf2	UTSW	13	92030853	missense	probably damaging	1.00
R6619:Rasgrf2	UTSW	13	92028519	missense	probably damaging	1.00
R6988:Rasgrf2	UTSW	13	91885635	missense	probably benign	0.02
R7026:Rasgrf2	UTSW	13	91983613	missense	probably damaging	1.00
R7038:Rasgrf2	UTSW	13	91982833	missense	possibly damaging	0.95
R7045:Rasgrf2	UTSW	13	92022592	intron	probably benign
R7056:Rasgrf2	UTSW	13	92030695	missense	probably damaging	0.99
R7058:Rasgrf2	UTSW	13	91886402	missense	probably damaging	0.99
R7256:Rasgrf2	UTSW	13	91884518	nonsense	probably null
R7392:Rasgrf2	UTSW	13	91893737	missense
R7469:Rasgrf2	UTSW	13	92029022	critical splice donor site	probably null
R7618:Rasgrf2	UTSW	13	91987966	missense
R7641:Rasgrf2	UTSW	13	92131406	missense	possibly damaging	0.65
R7784:Rasgrf2	UTSW	13	91896082	missense
R7962:Rasgrf2	UTSW	13	92030792	missense	probably damaging	0.99
R8056:Rasgrf2	UTSW	13	92030813	missense	probably damaging	0.97
R8218:Rasgrf2	UTSW	13	91982677	missense
R8796:Rasgrf2	UTSW	13	91890566	missense
R8913:Rasgrf2	UTSW	13	92022526	missense	probably benign	0.05
R8971:Rasgrf2	UTSW	13	92021717	missense	possibly damaging	0.80
R9020:Rasgrf2	UTSW	13	92028638	missense	possibly damaging	0.93
R9487:Rasgrf2	UTSW	13	92131251	missense	probably benign
R9562:Rasgrf2	UTSW	13	91886350	critical splice donor site	probably null
R9712:Rasgrf2	UTSW	13	91987973	missense
R9766:Rasgrf2	UTSW	13	92023680	missense	probably damaging	1.00
R9800:Rasgrf2	UTSW	13	92131352	missense	probably damaging	0.99
X0013:Rasgrf2	UTSW	13	92030855	missense	probably damaging	1.00
X0026:Rasgrf2	UTSW	13	91902535	missense	probably damaging	0.99
Z1177:Rasgrf2	UTSW	13	91983513	missense
Z1177:Rasgrf2	UTSW	13	92022573	missense	unknown

Predicted Primers

PCR Primer
(F):5'- AGGTACCTGCTTGTCCAAAG -3'
(R):5'- TACTTCGGGTGGAGTGACACTG -3'

Sequencing Primer
(F):5'- TTGTCCAAAGCGTCCCG -3'
(R):5'- ATAGGCGCCCTAGGTCTG -3'

Posted On

2019-11-12