Incidental Mutation 'R7674:Kpna3'
ID592397
Institutional Source Beutler Lab
Gene Symbol Kpna3
Ensembl Gene ENSMUSG00000021929
Gene Namekaryopherin (importin) alpha 3
SynonymsIPOA4
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.611) question?
Stock #R7674 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location61365211-61439874 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 61367637 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 520 (N520K)
Ref Sequence ENSEMBL: ENSMUSP00000022496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022496]
Predicted Effect probably benign
Transcript: ENSMUST00000022496
AA Change: N520K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022496
Gene: ENSMUSG00000021929
AA Change: N520K

DomainStartEndE-ValueType
Pfam:IBB 7 93 1e-25 PFAM
ARM 103 144 9.52e-11 SMART
ARM 146 186 2.15e-9 SMART
ARM 188 229 8.59e0 SMART
ARM 232 271 1.78e-1 SMART
ARM 273 313 4.31e-9 SMART
ARM 315 355 5.91e-7 SMART
ARM 357 397 5.22e-8 SMART
ARM 400 440 1.51e-4 SMART
Pfam:Arm_3 447 499 5.4e-25 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The transport of molecules between the nucleus and the cytoplasm in eukaryotic cells is mediated by the nuclear pore complex (NPC), which consists of 60-100 proteins. Small molecules (up to 70 kD) can pass through the nuclear pore by nonselective diffusion while larger molecules are transported by an active process. The protein encoded by this gene belongs to the importin alpha family, and is involved in nuclear protein import. [provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for a null mutation are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T G 3: 108,462,991 R698S probably damaging Het
Abca6 T A 11: 110,219,297 I607F probably damaging Het
Abcc4 A T 14: 118,611,487 D559E probably damaging Het
Abl1 T C 2: 31,689,829 V8A possibly damaging Het
Alkal1 A T 1: 6,389,488 Y96F probably damaging Het
Asb3 T A 11: 31,081,435 C352S possibly damaging Het
B4galnt3 G T 6: 120,215,205 D523E probably benign Het
Cadps C A 14: 12,411,581 E1258D probably damaging Het
Carmil2 A T 8: 105,697,286 Q1257L possibly damaging Het
Cars A G 7: 143,587,103 probably null Het
Ccdc88c G T 12: 100,945,232 A781E probably benign Het
Ccr10 A T 11: 101,174,649 D18E probably benign Het
Cdcp1 C A 9: 123,216,006 probably benign Het
Ces5a C A 8: 93,514,269 R400L probably damaging Het
Clcn6 C T 4: 148,012,694 V636M probably damaging Het
Cluh T A 11: 74,667,720 L1206H probably damaging Het
Cog2 C A 8: 124,537,882 N333K probably damaging Het
Dnah14 A T 1: 181,707,533 I2355L probably benign Het
Dok4 T C 8: 94,866,562 Y165C probably damaging Het
Dpy19l3 A C 7: 35,695,309 D601E probably damaging Het
Egr3 G A 14: 70,078,077 probably null Het
Evpl T C 11: 116,222,568 K1432R probably benign Het
Fbxw8 A T 5: 118,124,971 C214* probably null Het
Gm13088 T A 4: 143,655,605 K174* probably null Het
Gm45861 A C 8: 27,540,119 Y821S unknown Het
Gm5519 G C 19: 33,825,028 G157A probably benign Het
Gys1 T C 7: 45,455,071 S641P probably damaging Het
Ighv6-6 T A 12: 114,435,217 I10L probably benign Het
Ikbkap T C 4: 56,792,075 Q231R probably damaging Het
Jmy C T 13: 93,442,599 R675Q probably damaging Het
Kif14 C T 1: 136,468,820 T288I probably damaging Het
Lonp2 A T 8: 86,665,758 Q484L probably benign Het
Lrp1b T A 2: 42,652,909 probably benign Het
Mpeg1 A T 19: 12,461,387 M70L probably benign Het
Msh3 C A 13: 92,212,503 V1074L probably benign Het
Muc6 A T 7: 141,639,825 L1645Q unknown Het
Nipbl C T 15: 8,293,101 V2609I probably benign Het
Nucks1 C A 1: 131,931,106 T202N probably benign Het
Olfr1024 A C 2: 85,904,536 F173V probably damaging Het
Olfr119 A G 17: 37,700,682 N4S probably benign Het
Olfr1262 A T 2: 90,003,045 Y213F probably damaging Het
Olfr1509 A G 14: 52,450,442 T10A probably benign Het
Olfr870 A G 9: 20,171,253 L106P possibly damaging Het
Plekha2 A G 8: 25,057,298 S257P probably damaging Het
Pnlip G C 19: 58,675,154 G187A possibly damaging Het
Rasgrf2 C T 13: 92,131,406 S30N possibly damaging Het
Rho G T 6: 115,932,333 C110F probably damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Slc2a12 A G 10: 22,693,994 D528G probably damaging Het
Sorcs2 G A 5: 36,397,952 R32C probably damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Srp72 A T 5: 76,974,826 N35Y probably damaging Het
Tm2d2 C A 8: 25,018,264 Y141* probably null Het
Tor3a G A 1: 156,655,908 H315Y possibly damaging Het
Usp17la A T 7: 104,861,447 K420* probably null Het
Vmn2r26 T C 6: 124,039,362 W262R probably benign Het
Yipf7 A T 5: 69,519,229 V189D probably damaging Het
Zan T A 5: 137,467,108 M462L possibly damaging Het
Zc3h18 AGG AG 8: 122,383,556 probably null Het
Zfp930 A T 8: 69,228,685 H344L probably damaging Het
Other mutations in Kpna3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Kpna3 APN 14 61374288 missense possibly damaging 0.94
IGL00321:Kpna3 APN 14 61391853 splice site probably benign
IGL01013:Kpna3 APN 14 61370517 missense probably damaging 1.00
IGL01833:Kpna3 APN 14 61370445 missense possibly damaging 0.92
IGL02661:Kpna3 APN 14 61372949 splice site probably benign
IGL03070:Kpna3 APN 14 61370782 splice site probably benign
R1428:Kpna3 UTSW 14 61383220 splice site probably benign
R1719:Kpna3 UTSW 14 61387477 missense probably damaging 1.00
R1728:Kpna3 UTSW 14 61367701 missense probably benign 0.00
R1760:Kpna3 UTSW 14 61370541 missense probably benign 0.03
R1784:Kpna3 UTSW 14 61367701 missense probably benign 0.00
R2107:Kpna3 UTSW 14 61370484 missense possibly damaging 0.52
R4184:Kpna3 UTSW 14 61368175 missense probably damaging 0.96
R4952:Kpna3 UTSW 14 61370389 missense probably damaging 1.00
R5081:Kpna3 UTSW 14 61391245 missense probably damaging 0.97
R5766:Kpna3 UTSW 14 61403014 missense probably benign 0.07
R5887:Kpna3 UTSW 14 61403012 missense probably benign 0.04
R5927:Kpna3 UTSW 14 61384647 missense probably damaging 0.96
R7116:Kpna3 UTSW 14 61368186 missense probably benign 0.32
R7615:Kpna3 UTSW 14 61372962 missense possibly damaging 0.81
R7799:Kpna3 UTSW 14 61384733 missense probably damaging 1.00
R8115:Kpna3 UTSW 14 61370918 missense probably damaging 1.00
R8239:Kpna3 UTSW 14 61387470 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGACTTTTGGCAACTGCAAAG -3'
(R):5'- TGCAGATACAGGAACTTATGACAGAC -3'

Sequencing Primer
(F):5'- CTTTTGGCAACTGCAAAGTGACTG -3'
(R):5'- CATTCAGAGTTTCTCCTTTG -3'
Posted On2019-11-12