Incidental Mutation 'R7674:Egr3'
ID592398
Institutional Source Beutler Lab
Gene Symbol Egr3
Ensembl Gene ENSMUSG00000033730
Gene Nameearly growth response 3
SynonymsPilot
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.658) question?
Stock #R7674 (G1)
Quality Score173.009
Status Validated
Chromosome14
Chromosomal Location70077203-70082614 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 70078077 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000037042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035908] [ENSMUST00000035908] [ENSMUST00000225200]
Predicted Effect probably null
Transcript: ENSMUST00000035908
SMART Domains Protein: ENSMUSP00000037042
Gene: ENSMUSG00000033730

DomainStartEndE-ValueType
Pfam:DUF3446 87 156 3.6e-13 PFAM
ZnF_C2H2 275 299 3.95e-4 SMART
ZnF_C2H2 305 327 5.14e-3 SMART
ZnF_C2H2 333 355 1.45e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000035908
SMART Domains Protein: ENSMUSP00000037042
Gene: ENSMUSG00000033730

DomainStartEndE-ValueType
Pfam:DUF3446 87 156 3.6e-13 PFAM
ZnF_C2H2 275 299 3.95e-4 SMART
ZnF_C2H2 305 327 5.14e-3 SMART
ZnF_C2H2 333 355 1.45e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000225200
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional regulator that belongs to the EGR family of C2H2-type zinc-finger proteins. It is an immediate-early growth response gene which is induced by mitogenic stimulation. The protein encoded by this gene participates in the transcriptional regulation of genes in controling biological rhythm. It may also play a role in a wide variety of processes including muscle development, lymphocyte development, endothelial cell growth and migration, and neuronal development. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous null mutants exhibit partial postnatal lethality, sensory ataxia, resting tremors, blepharoptosis, scoliosis, muscle spindle agenesis, loss of myelinated proprioceptive neurons, and a defect in the strength of sensory-motor connections. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T G 3: 108,462,991 R698S probably damaging Het
Abca6 T A 11: 110,219,297 I607F probably damaging Het
Abcc4 A T 14: 118,611,487 D559E probably damaging Het
Abl1 T C 2: 31,689,829 V8A possibly damaging Het
Alkal1 A T 1: 6,389,488 Y96F probably damaging Het
Asb3 T A 11: 31,081,435 C352S possibly damaging Het
B4galnt3 G T 6: 120,215,205 D523E probably benign Het
Cadps C A 14: 12,411,581 E1258D probably damaging Het
Carmil2 A T 8: 105,697,286 Q1257L possibly damaging Het
Cars A G 7: 143,587,103 probably null Het
Ccdc88c G T 12: 100,945,232 A781E probably benign Het
Ccr10 A T 11: 101,174,649 D18E probably benign Het
Cdcp1 C A 9: 123,216,006 probably benign Het
Ces5a C A 8: 93,514,269 R400L probably damaging Het
Clcn6 C T 4: 148,012,694 V636M probably damaging Het
Cluh T A 11: 74,667,720 L1206H probably damaging Het
Cog2 C A 8: 124,537,882 N333K probably damaging Het
Dnah14 A T 1: 181,707,533 I2355L probably benign Het
Dok4 T C 8: 94,866,562 Y165C probably damaging Het
Dpy19l3 A C 7: 35,695,309 D601E probably damaging Het
Evpl T C 11: 116,222,568 K1432R probably benign Het
Fbxw8 A T 5: 118,124,971 C214* probably null Het
Gm13088 T A 4: 143,655,605 K174* probably null Het
Gm45861 A C 8: 27,540,119 Y821S unknown Het
Gm5519 G C 19: 33,825,028 G157A probably benign Het
Gys1 T C 7: 45,455,071 S641P probably damaging Het
Ighv6-6 T A 12: 114,435,217 I10L probably benign Het
Ikbkap T C 4: 56,792,075 Q231R probably damaging Het
Jmy C T 13: 93,442,599 R675Q probably damaging Het
Kif14 C T 1: 136,468,820 T288I probably damaging Het
Kpna3 A T 14: 61,367,637 N520K probably benign Het
Lonp2 A T 8: 86,665,758 Q484L probably benign Het
Lrp1b T A 2: 42,652,909 probably benign Het
Mpeg1 A T 19: 12,461,387 M70L probably benign Het
Msh3 C A 13: 92,212,503 V1074L probably benign Het
Muc6 A T 7: 141,639,825 L1645Q unknown Het
Nipbl C T 15: 8,293,101 V2609I probably benign Het
Nucks1 C A 1: 131,931,106 T202N probably benign Het
Olfr1024 A C 2: 85,904,536 F173V probably damaging Het
Olfr119 A G 17: 37,700,682 N4S probably benign Het
Olfr1262 A T 2: 90,003,045 Y213F probably damaging Het
Olfr1509 A G 14: 52,450,442 T10A probably benign Het
Olfr870 A G 9: 20,171,253 L106P possibly damaging Het
Plekha2 A G 8: 25,057,298 S257P probably damaging Het
Pnlip G C 19: 58,675,154 G187A possibly damaging Het
Rasgrf2 C T 13: 92,131,406 S30N possibly damaging Het
Rho G T 6: 115,932,333 C110F probably damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Slc2a12 A G 10: 22,693,994 D528G probably damaging Het
Sorcs2 G A 5: 36,397,952 R32C probably damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Srp72 A T 5: 76,974,826 N35Y probably damaging Het
Tm2d2 C A 8: 25,018,264 Y141* probably null Het
Tor3a G A 1: 156,655,908 H315Y possibly damaging Het
Usp17la A T 7: 104,861,447 K420* probably null Het
Vmn2r26 T C 6: 124,039,362 W262R probably benign Het
Yipf7 A T 5: 69,519,229 V189D probably damaging Het
Zan T A 5: 137,467,108 M462L possibly damaging Het
Zc3h18 AGG AG 8: 122,383,556 probably null Het
Zfp930 A T 8: 69,228,685 H344L probably damaging Het
Other mutations in Egr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01447:Egr3 APN 14 70079283 missense probably damaging 1.00
IGL03054:Egr3 UTSW 14 70079112 missense probably damaging 1.00
R1702:Egr3 UTSW 14 70079767 missense probably damaging 1.00
R4796:Egr3 UTSW 14 70077575 missense probably benign 0.15
R5911:Egr3 UTSW 14 70079448 missense probably damaging 0.99
R6514:Egr3 UTSW 14 70078917 missense probably damaging 0.98
R7887:Egr3 UTSW 14 70079202 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCATTACAATCAGATGGCTACAG -3'
(R):5'- GGAAAACCAGCCCATGTCTC -3'

Sequencing Primer
(F):5'- GCTAGCGATGGATGCACATATC -3'
(R):5'- AGCCCATGTCTCCACGG -3'
Posted On2019-11-12